FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene View larger

FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033678
Product type: DNA & cDNA
Ncbi symbol: FCGR3A
Origin species: Human
Product name: FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene
Size: 2ug
Accessions: BC033678
Gene id: 2214
Gene description: Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
Synonyms: CD16A; FCG3; FCGR3; FCGRIII; FCR-10; FCRIII; FCRIIIA; IGFR3; IMD20; low affinity immunoglobulin gamma Fc region receptor III-A; CD16a antigen; Fc fragment of IgG low affinity IIIa receptor; Fc fragment of IgG, low affinity III, receptor for (CD16); Fc fragment of IgG, low affinity IIIa, receptor (CD16a); Fc gamma receptor III-A; Fc gamma receptor IIIa; Fc-gamma RIII-alpha; Fc-gamma RIIIa; Fc-gamma receptor III-2 (CD 16); Fc-gamma receptor IIIb (CD16); FcgammaRIIIA; fc-gamma RIII; igG Fc receptor III-2; immunoglobulin G Fc receptor III; neutrophil-specific antigen NA; Fc fragment of IgG receptor IIIa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggcagctgctcctcccaactgctctgctacttctagtttcagctggcatgcggactgaagatctcccaaaggctgtggtgttcctggagcctcaatggtacagggtgctcgagaaggacagtgtgactctgaagtgccagggagcctactcccctgaggacaattccacacagtggtttcacaatgagagcctcatctcaagccaggcctcgagctacttcattgacgctgccacagttgacgacagtggagagtacaggtgccagacaaacctctccaccctcagtgacccggtgcagctagaagtccatatcggctggctgttgctccaggcccctcggtgggtgttcaaggaggaagaccctattcacctgaggtgtcacagctggaagaacactgctctgcataaggtcacatatttacagaatggcaaaggcaggaagtattttcatcataattctgacttctacattccaaaagccacactcaaagacagcggctcctacttctgcagggggcttgttgggagtaaaaatgtgtcttcagagactgtgaacatcaccatcactcaaggtttgtcagtgtcaaccatctcatcattctttccacctgggtaccaagtctctttctgcttggtgatggtactcctttttgcagtggacacaggactatatttctctgtgaagacaaacattcgaagctcaacaagagactggaaggaccataaatttaaatggagaaaggaccctcaagacaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - haloacid dehalogenase-like hydrolase domain containing 2
- major histocompatibility complex, class II, DR beta 5
- Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
- StAR-related lipid transfer (START) domain containing 7

Buy FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene now

Add to cart