Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FSD1L-fibronectin type III and SPRY domain containing 1-like Gene
PTXBC036746
New product
Data sheet of FSD1L-fibronectin type III and SPRY domain containing 1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FSD1L-fibronectin type III and SPRY domain containing 1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036746 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FSD1L |
| Origin species: | Human |
| Product name: | FSD1L-fibronectin type III and SPRY domain containing 1-like Gene |
| Size: | 2ug |
| Accessions: | BC036746 |
| Gene id: | 83856 |
| Gene description: | fibronectin type III and SPRY domain containing 1-like |
| Synonyms: | CCDC10; CSDUFD1; FSD1CL; FSD1NL; MIR1; FSD1-like protein; FSD1 C-terminal like; FSD1 N-terminal like; coiled-coil domain containing 10; cystatin and DUF19 domain containing 1; fibronectin type III and SPRY domain containing 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagaagaagataataagattgaccattttatactggaacataggaagactaattttgatggacttccacgtgtaaaggatgagcgatgctgggagataattgataatattaagggtactgaatatacactatcaggcttaaaatttgattcaaagtatatgaatttcagagtgcgagcttgtaacaaggctgtggctggagagtattctgatccagtgactctagagaccaaagcacttaacttcaatttggataactcctcatcccatttgaacctgaaagttgaagatacatgtgtagagtgggatcctactggaggaaaaggtcaagaaagtaaaattaaaggaaaagagaacaagggcagaagtggtacaccatccccaaaacgaacatctgtaggctccaggccaccagcagtaagaggcagtagagatcgttttactggagaatcatacacagtgctgggagacactgctattgaaagtggacaacattattgggaggtcaaggcccagaaggattgtaaatcctacagtgtgggagtagcatacaaaacgttggggaaatttgaccaattgggaaagacaaacactagttggtgtatccatgtcaacaactggctacaaaacacatttgcagcaaagcataataataaagtcaaagctttggatgttactgttcctgaaaaaataggtgtattttgtgattttgatgggggtcaactttcattctatgatgcaaattctaaacagttgctatattcctttaagacaaaatttactcagccagtactacctggtttcatggtatggtgtggtggactttctttgagtactgggatgcaggttccaagtgctgtgagaacacttcagaaaagtgaaaatggaatgactggttcagctagcagcctgaacaatgttgttactcaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - killer cell lectin-like receptor subfamily D, member 1 - recombination activating gene 1 activating protein 1 - SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) - cyclin-dependent kinase 5, regulatory subunit 1 (p35) |