SFI1-Sfi1 homolog, spindle assembly associated (yeast) Gene View larger

SFI1-Sfi1 homolog, spindle assembly associated (yeast) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SFI1-Sfi1 homolog, spindle assembly associated (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SFI1-Sfi1 homolog, spindle assembly associated (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033613
Product type: DNA & cDNA
Ncbi symbol: SFI1
Origin species: Human
Product name: SFI1-Sfi1 homolog, spindle assembly associated (yeast) Gene
Size: 2ug
Accessions: BC033613
Gene id: 9814
Gene description: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: SFI1 centrin binding protein; homolog of yeast Sfi1; Sfi1 homolog, spindle assembly associated; protein SFI1 homolog; PISD; PPP1R139; hSfi1p; protein phosphatase 1, regulatory subunit 139
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccaggcccaccccagcttacttgctgaccttggcctcgcctttcctgactttcagtctccctataaaattggagatcccacagagatctcagacccccctgcagcccctggtcagcccaggggaacagaccccatgtttctttccagcaacactgcccactcagcgaggaagcagccgcgacgcccacacttcctgttggagcctgcgcagagccagaggcctcagaagccacaggaacatggcctaggcatggctcagccagcagccccctccctgacgcggcccttcctggcagaggccccgacagcactggtcccacacagccccctgcctggggccctgtcaagcgcccctggcccgaagcagcccccgacggcaagcacaggcccggagctgctgctgctgcctctttcctccttcatgccctgcggggcggctgcaccagccagggtgtcagcacagcgggctactcctagggataagcccccggtcccctcatccctggccagtgtccctgacccccatctactccttcctggggacttctcagccaccagggctgggcctggactttcaactgcaggcagcctggaccttgaggctgaacttgaggagatccagcagcaactactgcactaccagaccaccaagcagaacctctggtcctgtcggcggcaagcgagcagcctgcgcaggtggctggagctgaacagagaggagccggggcctgaggaccaggaagtagagcagcaggtgcagaaagagctggaacaggtggaaatgcagatccagctgctggcagaggagctccaggctcagcgccagcccattggcgcctgcgttgcccgcatccaggccctgcggcaggccctgtgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphoribosyl transferase domain containing 1
- acyl-Coenzyme A dehydrogenase family, member 10
- SYF2 homolog, RNA splicing factor (S. cerevisiae)
- Ral GEF with PH domain and SH3 binding motif 1

Buy SFI1-Sfi1 homolog, spindle assembly associated (yeast) Gene now

Add to cart