Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SFI1-Sfi1 homolog, spindle assembly associated (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SFI1-Sfi1 homolog, spindle assembly associated (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033613 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SFI1 |
| Origin species: | Human |
| Product name: | SFI1-Sfi1 homolog, spindle assembly associated (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC033613 |
| Gene id: | 9814 |
| Gene description: | Sfi1 homolog, spindle assembly associated (yeast) |
| Synonyms: | SFI1 centrin binding protein; homolog of yeast Sfi1; Sfi1 homolog, spindle assembly associated; protein SFI1 homolog; PISD; PPP1R139; hSfi1p; protein phosphatase 1, regulatory subunit 139 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccaggcccaccccagcttacttgctgaccttggcctcgcctttcctgactttcagtctccctataaaattggagatcccacagagatctcagacccccctgcagcccctggtcagcccaggggaacagaccccatgtttctttccagcaacactgcccactcagcgaggaagcagccgcgacgcccacacttcctgttggagcctgcgcagagccagaggcctcagaagccacaggaacatggcctaggcatggctcagccagcagccccctccctgacgcggcccttcctggcagaggccccgacagcactggtcccacacagccccctgcctggggccctgtcaagcgcccctggcccgaagcagcccccgacggcaagcacaggcccggagctgctgctgctgcctctttcctccttcatgccctgcggggcggctgcaccagccagggtgtcagcacagcgggctactcctagggataagcccccggtcccctcatccctggccagtgtccctgacccccatctactccttcctggggacttctcagccaccagggctgggcctggactttcaactgcaggcagcctggaccttgaggctgaacttgaggagatccagcagcaactactgcactaccagaccaccaagcagaacctctggtcctgtcggcggcaagcgagcagcctgcgcaggtggctggagctgaacagagaggagccggggcctgaggaccaggaagtagagcagcaggtgcagaaagagctggaacaggtggaaatgcagatccagctgctggcagaggagctccaggctcagcgccagcccattggcgcctgcgttgcccgcatccaggccctgcggcaggccctgtgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphoribosyl transferase domain containing 1 - acyl-Coenzyme A dehydrogenase family, member 10 - SYF2 homolog, RNA splicing factor (S. cerevisiae) - Ral GEF with PH domain and SH3 binding motif 1 |