Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013155 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRYZL1 |
| Origin species: | Human |
| Product name: | CRYZL1-crystallin, zeta (quinone reductase)-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC013155 |
| Gene id: | 9946 |
| Gene description: | crystallin, zeta (quinone reductase)-like 1 |
| Synonyms: | 4P11; QOH-1; quinone oxidoreductase-like protein 1; crystallin, zeta (quinone reductase)-like 1; protein 4P11; quinone oxidoreductase homolog 1; quinone reductase-like 1; zeta-crystallin homolog; crystallin zeta like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaaggcttatatttccaacagagttccacagatgaagaaataacatttgtatttcaagaaaaggaagatcttcctgttacagaggataactttgtgaaacttcaagttaaagcttgtgctctgagccagataaatacaaagcttctggcagaaatgaagatgaaaaaggatttatttcctgttgggagagaaattgctggaattgtattagatgttggaagcaaggtatcattctttcaaccagatgatgaagtagttgaagtactttcccggctgggtgctgtggctcacgtctgtaatcccagcacgttgggaggccaaggtgggcgaatcacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ARP8 actin-related protein 8 homolog (yeast) - alkB, alkylation repair homolog 6 (E. coli) - golgi reassembly stacking protein 1, 65kDa - coagulation factor VIII, procoagulant component |