FXYD1-FXYD domain containing ion transport regulator 1 Gene View larger

FXYD1-FXYD domain containing ion transport regulator 1 Gene

PTXBC032800

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FXYD1-FXYD domain containing ion transport regulator 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FXYD1-FXYD domain containing ion transport regulator 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032800
Product type: DNA & cDNA
Ncbi symbol: FXYD1
Origin species: Human
Product name: FXYD1-FXYD domain containing ion transport regulator 1 Gene
Size: 2ug
Accessions: BC032800
Gene id: 5348
Gene description: FXYD domain containing ion transport regulator 1
Synonyms: PLM; phospholemman; FXYD domain containing ion transport regulator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtctcttggccacatcttggttttctgtgtgggtctcctcaccatggccaaggcagaaagtccaaaggaacacgacccgttcacttacgactaccagtccctgcagatcggaggcctcgtcatcgccgggatcctcttcatcctgggcatcctcatcgtgctgagcagaagatgccggtgcaagttcaaccagcagcagaggactggggaacccgatgaagaggagggaactttccgcagctccatccgccgtctgtccacccgcaggcggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Sfi1 homolog, spindle assembly associated (yeast)
- phosphoribosyl transferase domain containing 1
- acyl-Coenzyme A dehydrogenase family, member 10
- SYF2 homolog, RNA splicing factor (S. cerevisiae)

Buy FXYD1-FXYD domain containing ion transport regulator 1 Gene now

Add to cart