Login to display prices
Login to display prices
DYNLL2-dynein, light chain, LC8-type 2 Gene View larger

DYNLL2-dynein, light chain, LC8-type 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DYNLL2-dynein, light chain, LC8-type 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DYNLL2-dynein, light chain, LC8-type 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010744
Product type: DNA & cDNA
Ncbi symbol: DYNLL2
Origin species: Human
Product name: DYNLL2-dynein, light chain, LC8-type 2 Gene
Size: 2ug
Accessions: BC010744
Gene id: 140735
Gene description: dynein, light chain, LC8-type 2
Synonyms: DNCL1B; Dlc2; RSPH22; dynein light chain 2, cytoplasmic; 8 kDa dynein light chain b; DLC8b; radial spoke 22 homolog; dynein light chain LC8-type 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgaccggaaggcagtgatcaagaacgcagacatgtctgaggacatgcaacaggatgccgttgactgcgccacgcaggccatggagaagtacaatatagagaaggacattgctgcctatatcaagaaggaatttgacaagaaatataaccctacctggcattgtatcgtgggccgaaattttggcagctacgtcacacacgagacaaagcacttcatctatttttacttgggtcaagttgcaatcctcctcttcaagtcaggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - S100 calcium binding protein A6
- flavin containing monooxygenase 5
- S100 calcium binding protein A3
- membrane magnesium transporter 1