Login to display prices
Login to display prices
FMO5-flavin containing monooxygenase 5 Gene View larger

FMO5-flavin containing monooxygenase 5 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FMO5-flavin containing monooxygenase 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FMO5-flavin containing monooxygenase 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035687
Product type: DNA & cDNA
Ncbi symbol: FMO5
Origin species: Human
Product name: FMO5-flavin containing monooxygenase 5 Gene
Size: 2ug
Accessions: BC035687
Gene id: 2330
Gene description: flavin containing monooxygenase 5
Synonyms: dimethylaniline monooxygenase [N-oxide-forming] 5; FMO 5; dimethylaniline oxidase 5; hepatic flavin-containing monooxygenase 5; flavin containing monooxygenase 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactaagaaaagaattgctgtgattgggggaggagtgagcgggctctcttccatcaagtgctgcgtagaagaaggcttggaacctgtctgctttgaaaggactgatgacatcggagggctctggaggttccaggaaaatcctgaagaaggaagggccagtatttacaaatcagtgatcatcaatacttctaaagagatgatgtgcttcagtgactatccaatcccagatcattatcccaacttcatgcataatgcccaggtcctggagtatttcaggatgtatgccaaagaatttgaccttctaaagtatattcgatttaagaccactgtgtgcagtgtgaagaagcagcctgattttgccacttcaggccaatgggaagtggtcactgaatctgaagggaaaaaggagatgaatgtctttgatggagtcatggtttgcactggccatcacaccaatgctcatctacctctggaaagcttccctggaattgagaagttcaaagggcagtacttccacagtcgagactataagaacccagagggattcactggaaagagagtcattataattggcattgggaattctggaggggatctggctgtagagattagccaaacagccaagcaggttttcctcagcaccaggagaggggcttggatcctgaatcgtgtaggggactacggatatcctgctgatgtgttgttctcttctcgacttacacattttatatggaagatctgtggccaatcattagcaaacaaatatttggaaaaaaagataaaccaaaggtttgaccatgaaatgtttggcctgaagcctaaacacaggtctaaagacattgccctcacagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - S100 calcium binding protein A3
- membrane magnesium transporter 1
- transforming growth factor, alpha
- dual specificity phosphatase 19