Login to display prices
Login to display prices
DUSP19-dual specificity phosphatase 19 Gene View larger

DUSP19-dual specificity phosphatase 19 Gene

PTXBC035000

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP19-dual specificity phosphatase 19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP19-dual specificity phosphatase 19 Gene

Proteogenix catalog: PTXBC035000
Ncbi symbol: DUSP19
Product name: DUSP19-dual specificity phosphatase 19 Gene
Size: 2ug
Accessions: BC035000
Gene id: 142679
Gene description: dual specificity phosphatase 19
Synonyms: DUSP17; LMWDSP3; SKRP1; TS-DSP1; dual specificity protein phosphatase 19; SAPK pathway-regulating phosphatase 1; dual specificity phosphatase TS-DSP1; low molecular weight dual specificity phosphatase 3; protein phosphatase SKRP1; stress-activated protein kinase pathway-regulating phosphatase 1; dual specificity phosphatase 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtactcccttaaccaggaaattaaagcattctcccggaataatctcaggaagcaatgcaccagggtgacaacgctaactggaaagaaaattatagaaacatggaaagatgccagaattcatgttgtggaagaagtagagccgagcagtgggggtggttgtggttatgtgcaggaccttagctcggacctgcaagttggcgttattaagccatggttgctcctagggtcacaagatgctgctcatgatttggatacactgaaaaagaataaggtgactcatattcttaatgttgcatatggagttgaaaatgctttcctcagtgactttacatataagagcatttctatattggatctgcctgaaaccaacatcctgtcttattttccagaatgttttgaatttattgaagaagcaaaaagaaaagatggagtggttcttgttcattgtaatgcaggcgtttccagggctgctgcaattgtaataggtttcctgatgaattctgaacaaacctcatttaccagtgctttttctttggtgaaaaatgcaagaccttccatatgtccaaattctggcttcatggagcagcttcgtacatatcaagagggcaaagaaagcaataagtgtgacagaatacaggagaacagttcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: