Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of UBE2Z-ubiquitin-conjugating enzyme E2Z Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2Z-ubiquitin-conjugating enzyme E2Z Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015890 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2Z |
| Origin species: | Human |
| Product name: | UBE2Z-ubiquitin-conjugating enzyme E2Z Gene |
| Size: | 2ug |
| Accessions: | BC015890 |
| Gene id: | 65264 |
| Gene description: | ubiquitin-conjugating enzyme E2Z |
| Synonyms: | HOYS7; USE1; ubiquitin-conjugating enzyme E2 Z; E2 ubiquitin-conjugating enzyme Z; UBA6-specific enzyme E2; uba6-specific E2 conjugating enzyme 1; ubiquitin carrier protein Z; ubiquitin conjugating enzyme E2Z; ubiquitin-protein ligase Z; ubiquitin conjugating enzyme E2 Z |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccatttataaggagcctcctccaggaatgttcgttgtacctgatactgttgacatgactaagattcatgcattgatcacaggcccatttgacactccttatgaagggggtttcttcctgttcgtgtttcggtgtccgcccgactatcccatccacccacctcgggtcaaactgatgacaacgggcaataacacagtgaggtttaaccccaacttctaccgcaatgggaaagtctgcttgagtattctaggtacatggactggacctgcctggagcccagcccagagcatctcctcagtgctcatctctatccagtccctgatgactgagaacccctatcacaatgagcccggctttgaacaggagagacatccaggagacagcaaaaactataatgaatgtatccggcacgagaccatcagagttgcagtctgtgacatgatggaaggaaagtgtccctgtcctgaacccctacgaggggtgatggagaagtcctttctggagtattacgacttctatgaggtggcctgcaaagatcgcctgcaccttcaaggccaaactatgcaggacccttttggagagaagcggggccactttgactaccagtccctcttgatgcgcctgggactgatacgtcagaaagtgctggagaggctccataatgagaatgcagaaatggactctgatagcagttcatctgggacagagacagaccttcatgggagcctgagggtttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cell division cycle associated 8 - ribonuclease P/MRP 38kDa subunit - penta-EF-hand domain containing 1 - hypothetical protein MGC34761 |