UBE2Z-ubiquitin-conjugating enzyme E2Z Gene View larger

UBE2Z-ubiquitin-conjugating enzyme E2Z Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2Z-ubiquitin-conjugating enzyme E2Z Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2Z-ubiquitin-conjugating enzyme E2Z Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015890
Product type: DNA & cDNA
Ncbi symbol: UBE2Z
Origin species: Human
Product name: UBE2Z-ubiquitin-conjugating enzyme E2Z Gene
Size: 2ug
Accessions: BC015890
Gene id: 65264
Gene description: ubiquitin-conjugating enzyme E2Z
Synonyms: HOYS7; USE1; ubiquitin-conjugating enzyme E2 Z; E2 ubiquitin-conjugating enzyme Z; UBA6-specific enzyme E2; uba6-specific E2 conjugating enzyme 1; ubiquitin carrier protein Z; ubiquitin conjugating enzyme E2Z; ubiquitin-protein ligase Z; ubiquitin conjugating enzyme E2 Z
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccatttataaggagcctcctccaggaatgttcgttgtacctgatactgttgacatgactaagattcatgcattgatcacaggcccatttgacactccttatgaagggggtttcttcctgttcgtgtttcggtgtccgcccgactatcccatccacccacctcgggtcaaactgatgacaacgggcaataacacagtgaggtttaaccccaacttctaccgcaatgggaaagtctgcttgagtattctaggtacatggactggacctgcctggagcccagcccagagcatctcctcagtgctcatctctatccagtccctgatgactgagaacccctatcacaatgagcccggctttgaacaggagagacatccaggagacagcaaaaactataatgaatgtatccggcacgagaccatcagagttgcagtctgtgacatgatggaaggaaagtgtccctgtcctgaacccctacgaggggtgatggagaagtcctttctggagtattacgacttctatgaggtggcctgcaaagatcgcctgcaccttcaaggccaaactatgcaggacccttttggagagaagcggggccactttgactaccagtccctcttgatgcgcctgggactgatacgtcagaaagtgctggagaggctccataatgagaatgcagaaatggactctgatagcagttcatctgggacagagacagaccttcatgggagcctgagggtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle associated 8
- ribonuclease P/MRP 38kDa subunit
- penta-EF-hand domain containing 1
- hypothetical protein MGC34761

Buy UBE2Z-ubiquitin-conjugating enzyme E2Z Gene now

Add to cart