CDCA8-cell division cycle associated 8 Gene View larger

CDCA8-cell division cycle associated 8 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDCA8-cell division cycle associated 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDCA8-cell division cycle associated 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016944
Product type: DNA & cDNA
Ncbi symbol: CDCA8
Origin species: Human
Product name: CDCA8-cell division cycle associated 8 Gene
Size: 2ug
Accessions: BC016944
Gene id: 55143
Gene description: cell division cycle associated 8
Synonyms: BOR; BOREALIN; DasraB; MESRGP; Dasra B; cell division cycle-associated protein 8; dasra-B; hDasra-B; pluripotent embryonic stem cell-related gene 3 protein; cell division cycle associated 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcctaggaagggcagtagtcgggtggccaataccaactccttacggaggcggaagctcgcctcctttctgaaagacttcgaccgtgaagtggaaatacgaatcaagcaaattgagtcagacaggcagaacctcctcaaggaggtggataacctctacaacatcgagatcctgcggctccccaaggctctgcgcgagatgaactggcttgactacttcgcccttggaggaaacaaacaggccctggaagaggcggcaacagctgacctggatatcaccgaaataaacaaactaacagcagaagctattcagacacccctgaaatctgccaaaacacgaaaggtaatacaggtagatgaaatgatagtggaagaggaagaagaagaagaaaatgaacgtaagaatcttcaaactgcaagagtcaaaaggtgtcctccatccaagaagagaactcagtccatacaaggaaaaggaaaagggaaaaggtcaagccgtgctaacactgttaccccagccgtgggccgattggaggtgtccatggtcaaaccaactccaggcctgacacccaggtttgactcaagggtcttcaagacccctggcctgcgtactccagcagcaggagagcggatttacaacatctcagggaatggcagccctcttgctgacagcaaagagatcttcctcactgtgccagtgggcggcggagagagcctgcgattattggccagtgacttgcagaggcacagtattgcccagctggatccagaggccttgggaaacattaagaagctctccaaccgtctcgcccaaatctgcagcagcatacggacccacaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribonuclease P/MRP 38kDa subunit
- penta-EF-hand domain containing 1
- hypothetical protein MGC34761
- peroxisomal biogenesis factor 10

Buy CDCA8-cell division cycle associated 8 Gene now

Add to cart