RPP38-ribonuclease P/MRP 38kDa subunit Gene View larger

RPP38-ribonuclease P/MRP 38kDa subunit Gene

PTXBC029494

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPP38-ribonuclease P/MRP 38kDa subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPP38-ribonuclease P/MRP 38kDa subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029494
Product type: DNA & cDNA
Ncbi symbol: RPP38
Origin species: Human
Product name: RPP38-ribonuclease P/MRP 38kDa subunit Gene
Size: 2ug
Accessions: BC029494
Gene id: 10557
Gene description: ribonuclease P/MRP 38kDa subunit
Synonyms: ribonuclease P protein subunit p38; RNaseP protein p38; ribonuclease P/MRP 38kDa subunit; ribonuclease P/MRP subunit p38
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcagctcctcaagcaccggggcggggatctctccgtaagacgagacctctggttgtgaagacgtcgttgaacaacccatacatcatccgctggagcgctctggagagcgaggatatgcacttcatcctacagacgcttgaggacaggcttaaagctattggacttcagaagattgaagataagaagaaaaagaacaaaacaccttttctgaaaaaagaaagcagagagaaatgcagcattgctgttgatattagtgagaatctgaaggagaagaaaacagatgctaagcagcaagtgtcagggtggacgcctgcacacgtcaggaagcagcttgccattggcgttaacgaagttaccagagccctggaaaggagggaactgctgttagttctggtgtgtaaatcagtcaagcctgccatgatcacctcacacttgattcagttaagcctaagcagaagtgtccctgcctgtcaggtcccccggctcagtgagagaatcgcccccgtcattggcttaaaatgtgttctagccttggcgttcaaaaagaacaccactgactttgtggacgaagtaagagccatcatccccagagtccccagtttaagtgtaccatggcttcaagacagaattgaagattctggggaaaatttagagactgaacctctggaaagccaagacagagagcttttggacacttcatttgaagatctgtcaaaacctaagagaaagcttgctgacggtcggcaggcttctgtaacattacaaccccttaaaataaagaaactgattccaaaccctaataagataaggaaaccacccaaaagtaaaaaagctactccaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - penta-EF-hand domain containing 1
- hypothetical protein MGC34761
- peroxisomal biogenesis factor 10
- peroxisomal biogenesis factor 10

Buy RPP38-ribonuclease P/MRP 38kDa subunit Gene now

Add to cart