Login to display prices
Login to display prices
MMGT1-membrane magnesium transporter 1 Gene View larger

MMGT1-membrane magnesium transporter 1 Gene

PTXBC033588

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MMGT1-membrane magnesium transporter 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MMGT1-membrane magnesium transporter 1 Gene

Proteogenix catalog: PTXBC033588
Ncbi symbol: MMGT1
Product name: MMGT1-membrane magnesium transporter 1 Gene
Size: 2ug
Accessions: BC033588
Gene id: 93380
Gene description: membrane magnesium transporter 1
Synonyms: EMC5; TMEM32; membrane magnesium transporter 1; ER membrane protein complex subunit 5; transmembrane protein 32
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgccgtcgctgtggaaggggctggtgggcatcggtctctttgccctagcccacgccgccttttccgctgcgcagcatcgttcttatatgcgattaacagaaaaagaagatgaatcactgccaatagatatagttcttcagacacttctggcctttgcagttacctgttacggtatagttcatattgcaggagagtttaaagacatggatgccacttcagaactgaaaaataagacatttgatacgttaaggaatcacccatccttttatgtatttaatcatcgtggtcgagtacttttccggccttcggatacagcaaattcttcaaaccaagatgcattgtcctctaacacatcattgaagttacgaaaactcgaatcactgcgtcgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: