Login to display prices
Login to display prices
S100A3-S100 calcium binding protein A3 Gene View larger

S100A3-S100 calcium binding protein A3 Gene

PTXBC012893

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A3-S100 calcium binding protein A3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A3-S100 calcium binding protein A3 Gene

Proteogenix catalog: PTXBC012893
Ncbi symbol: S100A3
Product name: S100A3-S100 calcium binding protein A3 Gene
Size: 2ug
Accessions: BC012893
Gene id: 6274
Gene description: S100 calcium binding protein A3
Synonyms: S100E; protein S100-A3; S100 calcium binding protein A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaggcctctggagcaggcggtagctgccatcgtgtgcaccttccaggaatacgcagggcgctgtggggacaaatacaagctctgccaggcggagctcaaggagctgctgcagaaggagctggccacctggaccccgactgagtttcgggaatgtgactacaacaaattcatgagtgttctggacaccaacaaggactgcgaggtggactttgtggagtatgtgcgctcacttgcctgcctctgtctctactgccacgagtacttcaaggactgcccctcagagcccccctgctcccagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: