S100A3-S100 calcium binding protein A3 Gene View larger

S100A3-S100 calcium binding protein A3 Gene

PTXBC012893

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A3-S100 calcium binding protein A3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A3-S100 calcium binding protein A3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012893
Product type: DNA & cDNA
Ncbi symbol: S100A3
Origin species: Human
Product name: S100A3-S100 calcium binding protein A3 Gene
Size: 2ug
Accessions: BC012893
Gene id: 6274
Gene description: S100 calcium binding protein A3
Synonyms: S100E; protein S100-A3; S100 calcium binding protein A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaggcctctggagcaggcggtagctgccatcgtgtgcaccttccaggaatacgcagggcgctgtggggacaaatacaagctctgccaggcggagctcaaggagctgctgcagaaggagctggccacctggaccccgactgagtttcgggaatgtgactacaacaaattcatgagtgttctggacaccaacaaggactgcgaggtggactttgtggagtatgtgcgctcacttgcctgcctctgtctctactgccacgagtacttcaaggactgcccctcagagcccccctgctcccagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - membrane magnesium transporter 1
- transforming growth factor, alpha
- dual specificity phosphatase 19
- SET and MYND domain containing 3

Buy S100A3-S100 calcium binding protein A3 Gene now

Add to cart