S100A6-S100 calcium binding protein A6 Gene View larger

S100A6-S100 calcium binding protein A6 Gene

PTXBC001431

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A6-S100 calcium binding protein A6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A6-S100 calcium binding protein A6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001431
Product type: DNA & cDNA
Ncbi symbol: S100A6
Origin species: Human
Product name: S100A6-S100 calcium binding protein A6 Gene
Size: 2ug
Accessions: BC001431
Gene id: 6277
Gene description: S100 calcium binding protein A6
Synonyms: 2A9; 5B10; CABP; CACY; PRA; protein S100-A6; MLN 4; calcyclin; growth factor-inducible protein 2A9; prolactin receptor-associated protein; S100 calcium binding protein A6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatgccccctggatcaggccattggcctcctcgtggccatcttccacaagtactccggcagggagggtgacaagcacaccctgagcaagaaggagctgaaggagctgatccagaaggagctcaccattggctcgaagctgcaggatgctgaaattgcaaggctgatggaagacttggaccggaacaaggaccaggaggtgaacttccaggagtatgtcaccttcctgggggccttggctttgatctacaatgaagccctcaagggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - flavin containing monooxygenase 5
- S100 calcium binding protein A3
- membrane magnesium transporter 1
- transforming growth factor, alpha

Buy S100A6-S100 calcium binding protein A6 Gene now

Add to cart