Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 658,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 658,40 €
View larger 
LSM6-LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
PTXBC016026
New product
Data sheet of LSM6-LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LSM6-LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016026 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LSM6 |
| Origin species: | Human |
| Product name: | LSM6-LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC016026 |
| Gene id: | 11157 |
| Gene description: | LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
| Synonyms: | LSM6 homolog, U6 small nuclear RNA and mRNA degradation associated; LSM6 homolog, U6 small nuclear RNA associated; LSM6 U6 small nuclear RNA and mRNA degradation associated; U6 snRNA-associated Sm-like protein LSm6; YDR378C; Sm protein F |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtcttcggaagcaaacccctagtgacttcttaaagcaaatcatcggacgaccagttgtggtaaaattaaattctggagtggattatcgaggggtcctggcttgcctggatggctacatgaatatagccctggagcagacagaagaatatgtaaatggacaactgaagaataagtatggggatgcatttatccgaggaaacaatgtgttgtacatcagtacacagaagagacggatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa - serpin peptidase inhibitor, clade B (ovalbumin), member 8 - SEC22 vesicle trafficking protein homolog C (S. cerevisiae) - serpin peptidase inhibitor, clade B (ovalbumin), member 3 |