No products
Prices are tax excluded
PTXBC016026
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC016026 |
Product type: | DNA & cDNA |
Ncbi symbol: | LSM6 |
Origin species: | Human |
Product name: | LSM6-LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene |
Size: | 2ug |
Accessions: | BC016026 |
Gene id: | 11157 |
Gene description: | LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
Synonyms: | LSM6 homolog, U6 small nuclear RNA and mRNA degradation associated; LSM6 homolog, U6 small nuclear RNA associated; LSM6 U6 small nuclear RNA and mRNA degradation associated; U6 snRNA-associated Sm-like protein LSm6; YDR378C; Sm protein F |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgagtcttcggaagcaaacccctagtgacttcttaaagcaaatcatcggacgaccagttgtggtaaaattaaattctggagtggattatcgaggggtcctggcttgcctggatggctacatgaatatagccctggagcagacagaagaatatgtaaatggacaactgaagaataagtatggggatgcatttatccgaggaaacaatgtgttgtacatcagtacacagaagagacggatgtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa - serpin peptidase inhibitor, clade B (ovalbumin), member 8 - SEC22 vesicle trafficking protein homolog C (S. cerevisiae) - serpin peptidase inhibitor, clade B (ovalbumin), member 3 |