Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINB8-serpin peptidase inhibitor, clade B (ovalbumin), member 8 Gene
PTXBC034528
New product
Data sheet of SERPINB8-serpin peptidase inhibitor, clade B (ovalbumin), member 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINB8-serpin peptidase inhibitor, clade B (ovalbumin), member 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034528 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINB8 |
| Origin species: | Human |
| Product name: | SERPINB8-serpin peptidase inhibitor, clade B (ovalbumin), member 8 Gene |
| Size: | 2ug |
| Accessions: | BC034528 |
| Gene id: | 5271 |
| Gene description: | serpin peptidase inhibitor, clade B (ovalbumin), member 8 |
| Synonyms: | CAP2; PI8; PSS5; serpin B8; PI-8; cytoplasmic antiproteinase 2; peptidase inhibitor 8; protease inhibitor 8 (ovalbumin type); serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8; serpin peptidase inhibitor, clade B (ovalbumin), member 8; serpin family B member 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgacctctgtgaagcaaatggcacttttgccatcagcttatttaaaatattgggggaagaggacaactcaagaaacgtattcttctctcccatgagcatctcctctgccctggccatggtcttcatgggggcaaagggaagcactgcagcccagatgtcccaggcactttgtttatacaaagacggagatattcaccgaggtttccagtcacttctcagtgaagttaacagaactggcactcagtacttgcttagaactgccaacagactctttggagaaaagacgtgtgatttccttccagactttaaagaatactgtcagaagttctatcaggcagagctggaggagttgtcctttgctgaagacactgaagagtgcaggaagcatataaatgactgggtggcagagaagactgaaggtaagatttcagaggtactggatgctgggacagtcgatcccctgacaaagctagtccttgtgaatgccatttatttcaagggaaagtggaatgagcaatttgacagaaagtacacaaggggaatgctctttaaaaccaacgaggaaaaaaagacagtgcagatgatgtttaaggaagctaagtttaaaatggggtatgcggatgaggtacacacccaggtcctggagctgccctatgtggaagaggagctgagcatggtcattctgcttcccgatgacaacacggacctcgccgtgaaagagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SEC22 vesicle trafficking protein homolog C (S. cerevisiae) - serpin peptidase inhibitor, clade B (ovalbumin), member 3 - SHC (Src homology 2 domain containing) transforming protein 1 - dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) |