Login to display prices
Login to display prices
SERPINB8-serpin peptidase inhibitor, clade B (ovalbumin), member 8 Gene View larger

SERPINB8-serpin peptidase inhibitor, clade B (ovalbumin), member 8 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINB8-serpin peptidase inhibitor, clade B (ovalbumin), member 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINB8-serpin peptidase inhibitor, clade B (ovalbumin), member 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034528
Product type: DNA & cDNA
Ncbi symbol: SERPINB8
Origin species: Human
Product name: SERPINB8-serpin peptidase inhibitor, clade B (ovalbumin), member 8 Gene
Size: 2ug
Accessions: BC034528
Gene id: 5271
Gene description: serpin peptidase inhibitor, clade B (ovalbumin), member 8
Synonyms: CAP2; PI8; PSS5; serpin B8; PI-8; cytoplasmic antiproteinase 2; peptidase inhibitor 8; protease inhibitor 8 (ovalbumin type); serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8; serpin peptidase inhibitor, clade B (ovalbumin), member 8; serpin family B member 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgacctctgtgaagcaaatggcacttttgccatcagcttatttaaaatattgggggaagaggacaactcaagaaacgtattcttctctcccatgagcatctcctctgccctggccatggtcttcatgggggcaaagggaagcactgcagcccagatgtcccaggcactttgtttatacaaagacggagatattcaccgaggtttccagtcacttctcagtgaagttaacagaactggcactcagtacttgcttagaactgccaacagactctttggagaaaagacgtgtgatttccttccagactttaaagaatactgtcagaagttctatcaggcagagctggaggagttgtcctttgctgaagacactgaagagtgcaggaagcatataaatgactgggtggcagagaagactgaaggtaagatttcagaggtactggatgctgggacagtcgatcccctgacaaagctagtccttgtgaatgccatttatttcaagggaaagtggaatgagcaatttgacagaaagtacacaaggggaatgctctttaaaaccaacgaggaaaaaaagacagtgcagatgatgtttaaggaagctaagtttaaaatggggtatgcggatgaggtacacacccaggtcctggagctgccctatgtggaagaggagctgagcatggtcattctgcttcccgatgacaacacggacctcgccgtgaaagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
- serpin peptidase inhibitor, clade B (ovalbumin), member 3
- SHC (Src homology 2 domain containing) transforming protein 1
- dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)