Login to display prices
Login to display prices
DUS2L-dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) Gene View larger

DUS2L-dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) Gene

PTXBC006527

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUS2L-dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DUS2L-dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006527
Product type: DNA & cDNA
Ncbi symbol: DUS2L
Origin species: Human
Product name: DUS2L-dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC006527
Gene id: 54920
Gene description: dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)
Synonyms: DUS2L; SMM1; URLC8; tRNA-dihydrouridine(20) synthase [NAD(P)+]-like; SMM1 homolog; dihydrouridine synthase 2-like, SMM1 homolog; tRNA-dihydrouridine(20) synthase (NAD(P)(+)); up-regulated in lung cancer protein 8; dihydrouridine synthase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattttgaatagcctctctctgtgttaccataataagctaatcctggccccaatggttcgggtagggactcttccaatgaggctgctggccctggattatggagcggacattgtttactgtgaggagctgatcgacctcaagatgattcagtgcaagagagttgttaatgaggtgctcagcacagtggactttgtcgcccctgatgatcgagttgtcttccgcacctgtgaaagagagcagaacagggtggtcttccagatggggacttcagacgcagagcgagcccttgctgtggccaggcttgtagaaaatgatgtggctggtattgatgtcaacatgggctgtccaaaacaatattccaccaagggaggaatgggagctgccctgctgtcagaccctgacaagattgagaagatcctcagcactcttgttaaagggacacgcagacctgtgacctgcaagattcgcatcctgccatcgctagaagataccctgagccttgtgaagcggatagagaggactggcattgctgccatcgcagttcatgggaggaagcgggaggagcgacctcagcatcctgtcagctgtgaagtcatcaaagccattgctgataccctctccattcctgtcatagccaacggaggatctcatgaccacatccaacagtattcggacatagaggactttcgacaagccacggcagcctcttccgtgatggtggcccgagcagccatgtggaacccatctatcttcctcaaggagggtctgcggcccctggaggaggtcatgcagaaatacatcagatacgcggtgcagtatgacaaccactacaccaacaccaagtactgcttgtgccagatgctacgagaacagctggagtcgccccagggaaggttgctccatgctgcccagtcttcccgggaaatttgtgaggcctttggccttggtgccttctatgaggagaccacacaggagctggatgcccagcaggccaggctctcagccaagacttcagagcagacaggggagccagctgaagatacctctggtgtcattaagatggctgtcaagtttgaccggagagcatacccagcccagatcacccctaagatgtgcctactagagtggtgccggagggagaagttggcacagcctgtgtatgaaacggttcaacgccctctagatcgcctgttctcctctattgtcaccgttgctgaacaaaagtatcagtctaccttgtgggacaagtccaagaaactggcggagcaggctgcagccatcgtctgtctgcggagccagggcctccctgagggtcggctgggtgaggagagcccttccttgcacaagcgaaagagggaggctcctgaccaagaccctgggggccccagagctcaggagctagcacaacctggggatctgtgcaagaagccctttgtggccttgggaagtggtgaagaaagccccctggaaggctggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - up-regulated during skeletal muscle growth 5 homolog (mouse)
- LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
- LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa