USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene View larger

USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007087
Product type: DNA & cDNA
Ncbi symbol: USMG5
Origin species: Human
Product name: USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene
Size: 2ug
Accessions: BC007087
Gene id: 84833
Gene description: up-regulated during skeletal muscle growth 5 homolog (mouse)
Synonyms: DAPIT; HCVFTP2; bA792D24.4; up-regulated during skeletal muscle growth protein 5; Diabetes Associated Protein in Insulin-sensitive Tissues; HCV F-transactivated protein 2; diabetes-associated protein in insulin-sensitive tissues; upregulated during skeletal muscle growth 5 homolog; up-regulated during skeletal muscle growth 5 homolog (mouse)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggtccagaaagtgatgcgcaataccagttcactggtattaaaaaatatttcaactcttatactctcacaggtagaatgaactgtgtactggccacatatggaagcattgcattgattgtcttatatttcaagttaaggtccaaaaaaactccagctgtgaaagcaacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
- LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa
- LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)

Buy USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene now

Add to cart