Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene
PTXBC007087
New product
Data sheet of USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007087 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | USMG5 |
| Origin species: | Human |
| Product name: | USMG5-up-regulated during skeletal muscle growth 5 homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC007087 |
| Gene id: | 84833 |
| Gene description: | up-regulated during skeletal muscle growth 5 homolog (mouse) |
| Synonyms: | DAPIT; HCVFTP2; bA792D24.4; up-regulated during skeletal muscle growth protein 5; Diabetes Associated Protein in Insulin-sensitive Tissues; HCV F-transactivated protein 2; diabetes-associated protein in insulin-sensitive tissues; upregulated during skeletal muscle growth 5 homolog; up-regulated during skeletal muscle growth 5 homolog (mouse) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggtccagaaagtgatgcgcaataccagttcactggtattaaaaaatatttcaactcttatactctcacaggtagaatgaactgtgtactggccacatatggaagcattgcattgattgtcttatatttcaagttaaggtccaaaaaaactccagctgtgaaagcaacataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) - LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa - LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) |