LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene View larger

LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene

PTXBC005938

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005938
Product type: DNA & cDNA
Ncbi symbol: LSM5
Origin species: Human
Product name: LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
Size: 2ug
Accessions: BC005938
Gene id: 23658
Gene description: LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Synonyms: LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated; LSM5 homolog, U6 small nuclear RNA associated; LSM5 U6 small nuclear RNA and mRNA degradation associated; U6 snRNA-associated Sm-like protein LSm5; YER146W
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctaacgctactaccaacccgtcgcagctgctgccgttagagcttgtggacaaatgtataggatcaagaattcacatcgtgatgaagagtgataaggaaattgttggtactcttctaggatttgatgactttgtcaatatggtactggaagatgtcactgagtttgaaatcacaccagaaggaagaaggattactaaattagatcagattttgctaaatggaaataatataacaatgctggttcctggaggagaaggacctgaagtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa
- LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
- mesoderm induction early response 1 homolog (Xenopus laevis)

Buy LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene now

Add to cart