Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
PTXBC005938
New product
Data sheet of LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005938 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LSM5 |
| Origin species: | Human |
| Product name: | LSM5-LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC005938 |
| Gene id: | 23658 |
| Gene description: | LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
| Synonyms: | LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated; LSM5 homolog, U6 small nuclear RNA associated; LSM5 U6 small nuclear RNA and mRNA degradation associated; U6 snRNA-associated Sm-like protein LSm5; YER146W |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggctaacgctactaccaacccgtcgcagctgctgccgttagagcttgtggacaaatgtataggatcaagaattcacatcgtgatgaagagtgataaggaaattgttggtactcttctaggatttgatgactttgtcaatatggtactggaagatgtcactgagtttgaaatcacaccagaaggaagaaggattactaaattagatcagattttgctaaatggaaataatataacaatgctggttcctggaggagaaggacctgaagtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa - LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) - mesoderm induction early response 1 homolog (Xenopus laevis) |