Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINB3-serpin peptidase inhibitor, clade B (ovalbumin), member 3 Gene
PTXBC005224
New product
Data sheet of SERPINB3-serpin peptidase inhibitor, clade B (ovalbumin), member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINB3-serpin peptidase inhibitor, clade B (ovalbumin), member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005224 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINB3 |
| Origin species: | Human |
| Product name: | SERPINB3-serpin peptidase inhibitor, clade B (ovalbumin), member 3 Gene |
| Size: | 2ug |
| Accessions: | BC005224 |
| Gene id: | 6317 |
| Gene description: | serpin peptidase inhibitor, clade B (ovalbumin), member 3 |
| Synonyms: | HsT1196; SCC; SCCA-1; SCCA-PD; SCCA1; SSCA1; T4-A; serpin B3; protein T4-A; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3; serpin peptidase inhibitor, clade B (ovalbumin), member 3; squamous cell carcinoma antigen 1; serpin family B member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaattcactcagtgaagccaacaccaagttcatgttcgacctgttccaacagttcagaaaatcaaaagagaacaacatcttctattcccctatcagcatcacatcagcattagggatggtcctcttaggagccaaagacaacactgcacaacagattaagaaggttcttcactttgatcaagtcacagagaacaccacaggaaaagctgcaacatatcatgttgataggtcaggaaatgttcatcaccagtttcaaaagcttctgactgaattcaacaaatccactgatgcatatgagctgaagatcgccaacaagctcttcggagaaaaaacgtatctatttttacaggaatatttagatgccatcaagaaattttaccagaccagtgtggaatctgttgattttgcaaatgctccagaagaaagtcgaaagaagattaactcctgggtggaaagtcaaacgaatgaaaaaattaaaaacctaattcctgaaggtaatattggcagcaataccacattggttcttgtgaacgcaatctatttcaaagggcagtgggagaagaaatttaataaagaagatactaaagaggaaaaattttggccaaacaagaatacatacaagtccatacagatgatgaggcaatacacatcttttcattttgcctcgctggaggatgtacaggccaaggtcctggaaataccatacaaaggcaaagatctaagcatgattgtgttgctgccaaatgaaatcgatggtctccagaagcttgaagagaaactcactgctgagaaattgatggaatggacaagtttgcagaatatgagagagacacgtgtcgatttacacttacctcggttcaaagtggaagagagctatgacctcaaggacacgttgagaaccatgggaatggtggatatcttcaatggggatgcagacctctcaggcatgaccgggagccgcggtctcgtgctatctggagtcctacacaaggcctttgtggaggttacagaggagggagcagaagctgcagctgccaccgctgtagtaggattcggatcatcacctacttcaactaatgaagagttccattgtaatcaccctttcctattcttcataaggcaaaataagaccaacagcatcctcttctatggcagattctcatccccgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SHC (Src homology 2 domain containing) transforming protein 1 - dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) - up-regulated during skeletal muscle growth 5 homolog (mouse) - LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) |