SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene View larger

SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene

PTXBC006178

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006178
Product type: DNA & cDNA
Ncbi symbol: SEC22C
Origin species: Human
Product name: SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene
Size: 2ug
Accessions: BC006178
Gene id: 9117
Gene description: SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Synonyms: vesicle-trafficking protein SEC22c; SEC22L3; SEC22 vesicle trafficking protein homolog C; SEC22 vesicle trafficking protein-like 3; SEC22 vesicle trafficking protein-like protein C; secretion deficient 22C; SEC22 homolog C, vesicle trafficking protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgtgatcttttttgcctgcgtggtacgggtaagggatggactgcccctctcagcctctactgatttttaccacacccaagattttttggaatggaggagacggctcaagagtttagccttgcgactggcccagtatccaggtcgaggttctgcagaaggttgtgactttagtatacatttttcttctttcggggacgtggcctgcatggctatctgctcctgccagtgtccagcagccatggccttctgcttcctggagaccctgtggtgggaattcacagcttcctatgacactacctgcattggcctagcctccaggccatacgcttttcttgagtttgacagcatcattcagaaagtgaagtggcattttaactatgtaagttcctctcagatggagtgcagcttggaaaaaattcaggaggagctcaagttgcagcctccagcggttctcactctggaggacacagatgtggcaaatggggtgatgaatggtcacacaccgatgcacttggagcctgctcctaatttccgaatggaaccagtgacagccctgggtatcctctccctcattctcaacatcatgtgtgctgccctgaatctcattcgaggagttcaccttgcagaacattctttacaggttgcccatgaggaaattggaaacattctggcttttcttgttcctttcgtagcctgcattttccagtgttatttgtacctgttctacagtccagccaggactatgaaggtggtgcttatgctgctctttatttgcctgggcaacatgtacctgcacgggctgaggaacctctggcaaatccttttccacataggagtggcttttctgtcttcatatcagatactaacaaggcagcttcaggagaagcagtctgactgtggagtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade B (ovalbumin), member 3
- SHC (Src homology 2 domain containing) transforming protein 1
- dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)
- up-regulated during skeletal muscle growth 5 homolog (mouse)

Buy SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene now

Add to cart