Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFB3-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa Gene
PTXBC018183
New product
Data sheet of NDUFB3-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFB3-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018183 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFB3 |
| Origin species: | Human |
| Product name: | NDUFB3-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa Gene |
| Size: | 2ug |
| Accessions: | BC018183 |
| Gene id: | 4709 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa |
| Synonyms: | B12; CI-B12; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa; NADH-ubiquinone oxidoreductase B12 subunit; complex I-B12; NADH:ubiquinone oxidoreductase subunit B3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccatgaacatggacatgagcatggacatcataaaatggaacttccagattatagacaatggaagatagaagggacaccattagaaactatccagaagaagctggctgcaaaagggctaagggatccatggggccgcaatgaagcttggagatacatgggtggctttgcaaagagtgtttccttttctgatgtattctttaaaggattcaaatggggatttgctgcatttgtggtagctgtaggagctgaatattacctggagtccctgaataaagataagaagcatcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade B (ovalbumin), member 8 - SEC22 vesicle trafficking protein homolog C (S. cerevisiae) - serpin peptidase inhibitor, clade B (ovalbumin), member 3 - SHC (Src homology 2 domain containing) transforming protein 1 |