UGCGL2-UDP-glucose ceramide glucosyltransferase-like 2 Gene View larger

UGCGL2-UDP-glucose ceramide glucosyltransferase-like 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UGCGL2-UDP-glucose ceramide glucosyltransferase-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UGCGL2-UDP-glucose ceramide glucosyltransferase-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032302
Product type: DNA & cDNA
Ncbi symbol: UGCGL2
Origin species: Human
Product name: UGCGL2-UDP-glucose ceramide glucosyltransferase-like 2 Gene
Size: 2ug
Accessions: BC032302
Gene id: 55757
Gene description: UDP-glucose ceramide glucosyltransferase-like 2
Synonyms: UGCGL2; HUGT2; UGT2; UDP-glucose:glycoprotein glucosyltransferase 2; UDP-Glc:glycoprotein glucosyltransferase 2; UDP-glucose ceramide glucosyltransferase-like 1; UDP-glucose ceramide glucosyltransferase-like 2; UDP-glucose glycoprotein glucosyltransferase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgccagcgaaagccacgaacgtggtgcggctgctactaggctccacagcgctgtggctttcgcagctcggctccgggacggtcgccgcgtccaagtcggtgactgcccacttggccgcgaagtggcccgagaccccgctgctgctggaggcaagtgaatttatggcagaagaaagtaatgaaaaattttggcagtttttggaaactgtgcaagaattagcaatttataagcaaacagaatcagattattcttattacaacttaatcctgaagaaagctggacagtttctagacaatttacacatcaaccttttaaagtttgctttctctataagggcatactccccagctattcagatgtttcagcagattgcagctgatgagccaccaccagatggttgtaatgcatttgtggttattcataagaagcacacctgtaaaattaatgagattaaaaagctgctgaagaaagctgcttcaaggactagaccttatctatttaaaggagatcacaaatttcctacaaacaaagagaacttaccagtggtgattctctatgccgaaatgggtactagaacatttagtgcatttcacaaagtattgtctgaaaaagctcaaaatgaggaaattctgtatgttcttcgccattatattcagaaaccaagctcacggaaaatgtacttatctgggtatggtgtggagctagcaattaagagtacagaatacaaagcactggatgatacccaagttaaaactgtgactaatactactgtagaggatgagactgaaacaaatgaagttcaaggatttctctttgggaaactaaaatcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FXYD domain containing ion transport regulator 1
- Sfi1 homolog, spindle assembly associated (yeast)
- phosphoribosyl transferase domain containing 1
- acyl-Coenzyme A dehydrogenase family, member 10

Buy UGCGL2-UDP-glucose ceramide glucosyltransferase-like 2 Gene now

Add to cart