> >>SHFM1-split hand/foot malformation (ectrodactyly) type 1 Gene
SHFM1-split hand/foot malformation (ectrodactyly) type 1 Gene View larger

SHFM1-split hand/foot malformation (ectrodactyly) type 1 Gene

PTXBC032782

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of SHFM1-split hand/foot malformation (ectrodactyly) type 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SHFM1-split hand/foot malformation (ectrodactyly) type 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032782
Product type: DNA & cDNA
Ncbi symbol: SHFM1
Origin species: Human
Product name: SHFM1-split hand/foot malformation (ectrodactyly) type 1 Gene
Size: 2ug
Accessions: BC032782
Gene id: 7979
Gene description: split hand/foot malformation (ectrodactyly) type 1
Synonyms: SHFM1; DSS1; ECD; SHFD1; SHSF1; Shfdg1; 26S proteasome complex subunit DSS1; deleted in split hand/split foot protein 1; deleted in split-hand/split-foot 1; split hand/foot deleted protein 1; split hand/foot malformation (ectrodactyly) type 1; split hand/foot malformation type 1 protein; SEM1, 26S proteasome complex subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagagaaaaagcagccggtagacttaggtctgttagaggaagacgacgagtttgaagagttccctgccgaagactgggctggcttagatgaagatgaagatgcacatgtctgggaggataattgggatgatgacaatgtagaggatgacttctctaatcagttacgagctgaactagagaaacatggttataagatggagacttcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RanBP-type and C3HC4-type zinc finger containing 1
- ATP-binding cassette, sub-family D (ALD), member 3
- ORAI calcium release-activated calcium modulator 1
- mitochondrial translational release factor 1-like

Reviews

Buy SHFM1-split hand/foot malformation (ectrodactyly) type 1 Gene now

Add to cart