MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene View larger

MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010518
Product type: DNA & cDNA
Ncbi symbol: MLC1
Origin species: Human
Product name: MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene
Size: 2ug
Accessions: BC010518
Gene id: 23209
Gene description: megalencephalic leukoencephalopathy with subcortical cysts 1
Synonyms: membrane protein MLC1; LVM; MLC; megalencephalic leukoencephalopathy with subcortical cysts 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatctgtggcctggggccatcaagatcaaagaaccaggaggcctgggagatgcagctggatggggcggcctgcagaccctgccagggggtttgaggaccctcccaggtttcccactgcggaacaggagtgactctggctgccaagataccttcatggtgttcatgacaagtggaatcattattttcaaccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small nuclear RNA activating complex, polypeptide 3, 50kDa
- EGF-containing fibulin-like extracellular matrix protein 2
- Smith-Magenis syndrome chromosome region, candidate 7-like
- interferon-induced protein with tetratricopeptide repeats 5

Buy MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene now

Add to cart