Login to display prices
Login to display prices
MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene View larger

MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene

Proteogenix catalog: PTXBC010518
Ncbi symbol: MLC1
Product name: MLC1-megalencephalic leukoencephalopathy with subcortical cysts 1 Gene
Size: 2ug
Accessions: BC010518
Gene id: 23209
Gene description: megalencephalic leukoencephalopathy with subcortical cysts 1
Synonyms: membrane protein MLC1; LVM; MLC; megalencephalic leukoencephalopathy with subcortical cysts 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatctgtggcctggggccatcaagatcaaagaaccaggaggcctgggagatgcagctggatggggcggcctgcagaccctgccagggggtttgaggaccctcccaggtttcccactgcggaacaggagtgactctggctgccaagataccttcatggtgttcatgacaagtggaatcattattttcaaccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: