Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TIGD5-tigger transposable element derived 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIGD5-tigger transposable element derived 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032632 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIGD5 |
| Origin species: | Human |
| Product name: | TIGD5-tigger transposable element derived 5 Gene |
| Size: | 2ug |
| Accessions: | BC032632 |
| Gene id: | 84948 |
| Gene description: | tigger transposable element derived 5 |
| Synonyms: | CI-MNLL; CI-SGDH; MNLL; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 1; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa; NADH-ubiquinone oxidoreductase MNLL subunit; complex I MNLL subunit; complex I-MNLL; NADH:ubiquinone oxidoreductase subunit B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccgccctggacagcgaggatgcccccgtgcggtgcaggccggagcccctcggtcccccggaggagctgcagacaccggatggcgctgtgcgggtgctgttcctgtccaaaggcagcagccgggcacatatccccgcaccgctggagcagggcgtggtggccgccttcaaacagctgtacaagcgcgagctgctgcgactggctgtgtcctgcgccagcggctccccgctggacttcatgcgcagcttcatgctcaaggacatgctctacctggctggcctctcctgggacctggtgcaggcgggcagcattgagcgctgctggctgctgggcctgcgggctgccttcgagccccggcccggcgaggacagtgctgggcagccggcccaggccgaggaagccgccgagcacagcagggtgctcagcgacctcacccacctggcggctctggcctacaagtgcctggctccggaggaggttgcggagtggctgcacctggacgatgatgggggtccgcccgagggctgcagggaggaggtgggcccagccctgccccctgcagcgcctccggccccagccagtctgccctctgccattgggggcggagaggacgaggaggaggccaccgactatggagggacctcagtgccgactgccggggaggccgtgcgggggctagaaacagctctgcggtggctggagaaccaggaccccagagaggtggggccactgaggctggtgcagttgcgctcactcatcagcatggcccggaggctggggggcatctggcataccccagcaggcccctatgacggtgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras homolog enriched in brain like 1 - GAR1 ribonucleoprotein homolog (yeast) - Na+/H+ exchanger domain containing 1 - GINS complex subunit 4 (Sld5 homolog) |