TIGD5-tigger transposable element derived 5 Gene View larger

TIGD5-tigger transposable element derived 5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIGD5-tigger transposable element derived 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TIGD5-tigger transposable element derived 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032632
Product type: DNA & cDNA
Ncbi symbol: TIGD5
Origin species: Human
Product name: TIGD5-tigger transposable element derived 5 Gene
Size: 2ug
Accessions: BC032632
Gene id: 84948
Gene description: tigger transposable element derived 5
Synonyms: CI-MNLL; CI-SGDH; MNLL; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 1; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa; NADH-ubiquinone oxidoreductase MNLL subunit; complex I MNLL subunit; complex I-MNLL; NADH:ubiquinone oxidoreductase subunit B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccgccctggacagcgaggatgcccccgtgcggtgcaggccggagcccctcggtcccccggaggagctgcagacaccggatggcgctgtgcgggtgctgttcctgtccaaaggcagcagccgggcacatatccccgcaccgctggagcagggcgtggtggccgccttcaaacagctgtacaagcgcgagctgctgcgactggctgtgtcctgcgccagcggctccccgctggacttcatgcgcagcttcatgctcaaggacatgctctacctggctggcctctcctgggacctggtgcaggcgggcagcattgagcgctgctggctgctgggcctgcgggctgccttcgagccccggcccggcgaggacagtgctgggcagccggcccaggccgaggaagccgccgagcacagcagggtgctcagcgacctcacccacctggcggctctggcctacaagtgcctggctccggaggaggttgcggagtggctgcacctggacgatgatgggggtccgcccgagggctgcagggaggaggtgggcccagccctgccccctgcagcgcctccggccccagccagtctgccctctgccattgggggcggagaggacgaggaggaggccaccgactatggagggacctcagtgccgactgccggggaggccgtgcgggggctagaaacagctctgcggtggctggagaaccaggaccccagagaggtggggccactgaggctggtgcagttgcgctcactcatcagcatggcccggaggctggggggcatctggcataccccagcaggcccctatgacggtgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Ras homolog enriched in brain like 1
- GAR1 ribonucleoprotein homolog (yeast)
- Na+/H+ exchanger domain containing 1
- GINS complex subunit 4 (Sld5 homolog)

Buy TIGD5-tigger transposable element derived 5 Gene now

Add to cart