Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR2K-polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Gene
PTXBC000806
New product
Data sheet of POLR2K-polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR2K-polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000806 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR2K |
| Origin species: | Human |
| Product name: | POLR2K-polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Gene |
| Size: | 2ug |
| Accessions: | BC000806 |
| Gene id: | 5440 |
| Gene description: | polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa |
| Synonyms: | ABC10-alpha; RPABC4; RPB10alpha; RPB12; RPB7.0; hRPB7.0; hsRPB10a; DNA-directed RNA polymerases I, II, and III subunit RPABC4; DNA directed RNA polymerases I, II, and III 7.0 kda polypeptide; DNA-directed RNA polymerase II subunit K; RNA polymerase II 7.0 kDa subunit; RNA polymerases I, II, and III subunit ABC4; polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa; polymerase (RNA) II subunit K; RNA polymerase II subunit K |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacacccagaaggacgttcaacctccaaagcagcaaccaatgatatatatctgtggagagtgtcacacagaaaatgaaataaaatctagggatccaatcagatgcagagaatgtggatacagaataatgtacaagaaaaggactaaaagattggtcgtttttgatgctcgatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - similar to metallo-beta-lactamase superfamily protein - biogenesis of lysosomal organelles complex-1, subunit 2 - ribosomal modification protein rimK-like family member B - oligodendrocytic myelin paranodal and inner loop protein |