Login to display prices
Login to display prices
POLR2K-polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Gene View larger

POLR2K-polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Gene

PTXBC000806

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLR2K-polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLR2K-polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000806
Product type: DNA & cDNA
Ncbi symbol: POLR2K
Origin species: Human
Product name: POLR2K-polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Gene
Size: 2ug
Accessions: BC000806
Gene id: 5440
Gene description: polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Synonyms: ABC10-alpha; RPABC4; RPB10alpha; RPB12; RPB7.0; hRPB7.0; hsRPB10a; DNA-directed RNA polymerases I, II, and III subunit RPABC4; DNA directed RNA polymerases I, II, and III 7.0 kda polypeptide; DNA-directed RNA polymerase II subunit K; RNA polymerase II 7.0 kDa subunit; RNA polymerases I, II, and III subunit ABC4; polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa; polymerase (RNA) II subunit K; RNA polymerase II subunit K
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacacccagaaggacgttcaacctccaaagcagcaaccaatgatatatatctgtggagagtgtcacacagaaaatgaaataaaatctagggatccaatcagatgcagagaatgtggatacagaataatgtacaagaaaaggactaaaagattggtcgtttttgatgctcgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - similar to metallo-beta-lactamase superfamily protein
- biogenesis of lysosomal organelles complex-1, subunit 2
- ribosomal modification protein rimK-like family member B
- oligodendrocytic myelin paranodal and inner loop protein