Login to display prices
Login to display prices
LOC153364-similar to metallo-beta-lactamase superfamily protein Gene View larger

LOC153364-similar to metallo-beta-lactamase superfamily protein Gene

PTXBC038230

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC153364-similar to metallo-beta-lactamase superfamily protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC153364-similar to metallo-beta-lactamase superfamily protein Gene

Proteogenix catalog: PTXBC038230
Ncbi symbol: LOC153364
Product name: LOC153364-similar to metallo-beta-lactamase superfamily protein Gene
Size: 2ug
Accessions: BC038230
Gene id: 153364
Gene description: similar to metallo-beta-lactamase superfamily protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggcgctcgagtggtacgcccacaagtctctaggcgatggtatcttctggattcaagaacgtttctacgagtcgggcaaccgtgccaacatctggctggtgcgcggctccgagcaggacgtggtgatcgatacaggcctggggctgcgcagcctcccggagtacctgtactcctccggcctcttgcaggaccgagaggccaaagaggacgcggcgcgccggccactgcttgccgtggccacccacgtgcacttcgaccactccggcggcctctaccagttcgaccgcgtggcagtgcaccacgccgaggccgaggcgctggctcgcggggacaactttgagaccgtgacctggctttccgatagcgaggtggtgcgggcgcccagccccggctggagggccagacagttccgggtacaggcggtgcagcccaccctcatcctgcaggatggggatgtgatcaaccttggtgacagacagctcactgttatgcacatgccaggtcactccaggggcagtatttgcttacatgacaaagaccgaaagattctcttcagtggagacgtcgtgtatgatggatcactgattgactggctcccatacagcaggataagtgactatgttggaacttgtgaacgtctaatagaattagtggacagaggtctggtagagaaggtgcttcctgggcacttcaatacctttggtgctgaaaggctttttcgattggcttctaactatatttcaaaagctgggatatgtcacaaagtttctacttttgccatgcgatctcttgcaagtttagctctacgtgtaacaaattctaggacctcgccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: