Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SDHALP2-succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 2 Gene
PTXBC053551
New product
Data sheet of SDHALP2-succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SDHALP2-succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC053551 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SDHALP2 |
| Origin species: | Human |
| Product name: | SDHALP2-succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 2 Gene |
| Size: | 2ug |
| Accessions: | BC053551 |
| Gene id: | 727956 |
| Gene description: | succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggaggacaactggaggtggcatttctatgacaccgtgaagggctccgactggctgggggaccaggatgccatccactacgtgacggagcaggcccccactgccatggtcgaggtagaaaattatggcatgccgtttagcagaactgaagatgggaagatttatcagcgtgcatttggcggacacagcctcaagtttggaaagggcaggcaggcccatcggtgctgctgtgtggctgatcggaccggccactcaatattgcacaccttatatgggaggtctctgcgatatgataccagctgttttgtggagtattttgccttggatctcctgatggagaatggggagtgccgtggtgtcttcgcactgtgcatacaggacgggtccatccatcgcataagagcaaagaatactattgttgccacagggtacttgggaggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - split hand/foot malformation (ectrodactyly) type 1 - RanBP-type and C3HC4-type zinc finger containing 1 - ATP-binding cassette, sub-family D (ALD), member 3 - ORAI calcium release-activated calcium modulator 1 |