No products
Prices are tax excluded
PTXBC141826
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC141826 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCGR2B |
| Origin species: | Human |
| Product name: | FCGR2B-Fc fragment of IgG, low affinity IIb, receptor (CD32) Gene |
| Size: | 2ug |
| Accessions: | BC141826 |
| Gene id: | 2213 |
| Gene description: | Fc fragment of IgG, low affinity IIb, receptor (CD32) |
| Synonyms: | CD32; CD32B; FCG2; FCGR2; IGFR2; low affinity immunoglobulin gamma Fc region receptor II-b; CDw32; Fc fragment of IgG, low affinity II, receptor for (CD32); Fc fragment of IgG, low affinity IIb, receptor (CD32); Fc fragment of IgG, low affinity IIb, receptor for (CD32); Fc gamma RIIb; Fc gamma receptor IIb; fc-gamma RII-b; fc-gamma-RIIb; fcRII-b; igG Fc receptor II-b; Fc fragment of IgG receptor IIb |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaatcctgtcattcttacctgtccttgccactgagagtgactgggctgactgcaagtccccccagccttggggtcatatgcttctgtggacagctgtgctattcctggctcctgttgctgggacacctgcagctcccccaaaggctgtgctgaaactcgagccccagtggatcaacgtgctccaggaggactctgtgactctgacatgccgggggactcacagccctgagagcgactccattcagtggttccacaatgggaatctcattcccacccacacgcagcccagctacaggttcaaggccaacaacaatgacagcggggagtacacgtgccagactggccagaccagcctcagcgaccctgtgcatctgactgtgctttctgagtggctggtgctccagacccctcacctggagttccaggagggagaaaccatcgtgctgaggtgccacagctggaaggacaagcctctggtcaaggtcacattcttccagaatggaaaatccaagaaattttcccgttcggatcccaacttctccatcccacaagcaaaccacagtcacagtggtgattaccactgcacaggaaacataggctacacgctgtactcatccaagcctgtgaccatcactgtccaagctcccagctcttcaccgatggggatcattgtggctgtggtcactgggactgctgtagcggccattgttgctgctgtagtggccttgatctactgcaggaaaaagcggatttcagccaatcccactaatcctgatgaggctgacaaagttggggctgagaacacaatcacctattcacttctcatgcacccggatgctctggaagagcctgatgaccagaaccgtatttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - microtubule-associated protein 1 light chain 3 beta - SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) - RNA binding motif, single stranded interacting protein - hypothetical protein BC008131 |