Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MAP1LC3B-microtubule-associated protein 1 light chain 3 beta Gene
PTXBC045759
New product
Data sheet of MAP1LC3B-microtubule-associated protein 1 light chain 3 beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAP1LC3B-microtubule-associated protein 1 light chain 3 beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC045759 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAP1LC3B |
| Origin species: | Human |
| Product name: | MAP1LC3B-microtubule-associated protein 1 light chain 3 beta Gene |
| Size: | 2ug |
| Accessions: | BC045759 |
| Gene id: | 81631 |
| Gene description: | microtubule-associated protein 1 light chain 3 beta |
| Synonyms: | MAP1LC3B-a; ATG8F; LC3B; MAP1A/1BLC3; microtubule-associated proteins 1A/1B light chain 3B; MAP1 light chain 3-like protein 2; MAP1A/MAP1B LC3 B; MAP1A/MAP1B light chain 3 B; autophagy-related ubiquitin-like modifier LC3 B; microtubule associated protein 1 light chain 3 beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgagctcatcaagataattagaaggcgcttacagctcaatgctaatcaggccttcttcctgttggtgaacggacacagcatggtcagcgtctccacaccaatctcagaggtgtatgagagtgagaaagatgaagatggattcctgtacatggtctatgcctcccaggagacgttcgggatgaaattgtcagtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) - RNA binding motif, single stranded interacting protein - hypothetical protein BC008131 - interleukin 1 receptor antagonist |