Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC2A4-solute carrier family 2 (facilitated glucose transporter), member 4 Gene
PTXBC034387
New product
Data sheet of SLC2A4-solute carrier family 2 (facilitated glucose transporter), member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC2A4-solute carrier family 2 (facilitated glucose transporter), member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034387 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC2A4 |
| Origin species: | Human |
| Product name: | SLC2A4-solute carrier family 2 (facilitated glucose transporter), member 4 Gene |
| Size: | 2ug |
| Accessions: | BC034387 |
| Gene id: | 6517 |
| Gene description: | solute carrier family 2 (facilitated glucose transporter), member 4 |
| Synonyms: | solute carrier family 2, facilitated glucose transporter member 4; GLUT-4; glucose transporter type 4, insulin-responsive; insulin-responsive glucose transporter type 4; solute carrier family 2 (facilitated glucose transporter), member 4; solute carrier family 2 member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgtcgggcttccaacagataggctccgaagatggggaaccccctcagcagcgagtgactgggaccctggtccttgctgtgttctctgcggtgcttggctccctgcagtttgggtacaacattggggtcatcaatgcccctcagaaggtgattgaacagagctacaatgagacgtggctggggaggcaggggcctgagggacccagctccatccctccaggcaccctcaccaccctctgggccctctccgtggccatcttttccgtgggcggcatgatttcctccttcctcattggtatcatctctcagtggcttggaaggaaaagggccatgctggtcaacaatgtcctggcggtgctggggggcagcctcatgggcctggccaacgctgctgcctcctatgaaatgctcatccttggacgattcctcattggcgcctactcagggctgacatcagggctggtgcccatgtacgtgggggagattgctcccactcacctgcggggcgccctggggacgctcaaccaactggccattgttatcggcattctgatcgcccaggtgctgggcttggagtccctcctgggcactgccagcctgtggccactgctcctgggcctcacagtgctacctgccctcctgcagctggtcctgctgcccttctgtcccgagagcccccgctacctctacatcatccagaatctcgaggggcctgccagaaagagtctgaagcgcctgacaggctgggccgatgtttctggagtgctggctgagctgaaggatgagaagcggaagctggagcgtgagcggccactgtccctgctccagctcctgggcagccgtacccaccggcagcccctgatcattgcggtcgtgctgcagctgagccagcagctctctggcatcaatgctgttttctattattcgaccagcatcttcgagacagcaggggtaggccagcctgcctatgccaccataggagctggtgtggtcaacacagtcttcaccttggtctcggtaactgctcacctctggaatggcccgagccactggcttcacctccctgggtgtcccggaggtgttgttggtggagcgggcggggcgccggacgctccatctcctgggcctggcgggcatgtgtggctgtgccatcctgatgactgtggctctgctcctgctggagcgagttccagccatgagctacgtctccattgtggccatctttggcttcgtggcattttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - echinoderm microtubule associated protein like 4 - cytochrome c oxidase subunit VIa polypeptide 2 - intermediate filament tail domain containing 1 - SUMO/sentrin specific peptidase family member 8 |