EML4-echinoderm microtubule associated protein like 4 Gene View larger

EML4-echinoderm microtubule associated protein like 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EML4-echinoderm microtubule associated protein like 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EML4-echinoderm microtubule associated protein like 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008685
Product type: DNA & cDNA
Ncbi symbol: EML4
Origin species: Human
Product name: EML4-echinoderm microtubule associated protein like 4 Gene
Size: 2ug
Accessions: BC008685
Gene id: 27436
Gene description: echinoderm microtubule associated protein like 4
Synonyms: C2orf2; ELP120; EMAP-4; EMAPL4; ROPP120; echinoderm microtubule-associated protein-like 4; restrictedly overexpressed proliferation-associated protein; ropp 120; echinoderm microtubule associated protein like 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgctatactccctgcaagaaatatactgacatgaacaggcagttcttggagaagaaagagcatttctttaagtacctggggaatacagctctcagtgatcagcagggagtttatttgaggacatcagtcacctttggggttgccatgtacaatgagatttataatcatgatactcttcggtggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome c oxidase subunit VIa polypeptide 2
- intermediate filament tail domain containing 1
- SUMO/sentrin specific peptidase family member 8
- transcription elongation factor A (SII)-like 4

Buy EML4-echinoderm microtubule associated protein like 4 Gene now

Add to cart