IFLTD1-intermediate filament tail domain containing 1 Gene View larger

IFLTD1-intermediate filament tail domain containing 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFLTD1-intermediate filament tail domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IFLTD1-intermediate filament tail domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037957
Product type: DNA & cDNA
Ncbi symbol: IFLTD1
Origin species: Human
Product name: IFLTD1-intermediate filament tail domain containing 1 Gene
Size: 2ug
Accessions: BC037957
Gene id: 160492
Gene description: intermediate filament tail domain containing 1
Synonyms: IFLTD1; lamin tail domain-containing protein 1; intermediate filament tail domain containing 1; intermediate filament tail domain-containing protein 1; lamin tail domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattggggatggagaagattatttcctttctttgtttggtgattcaaagaaacttacagcacactcaaactacactcagaaaactttaaaatacttttctatgattcttgaagaagttggccaatttacctccagttctcttggagatgttgaaatagctgaagtgaatgtcaagggtttgttcgtgaagctcattaactcttcccttgacaaagaaatggcaattggagatcatattctccagcaaaatgtgaatggacaaaccatttctttgtaccgattccttccaaacatcgtaatgcaggcaaattccacagtaacagtgtgggcagcagcatctgaagcaaagcatcaacctccatcagattttctttggaaggaacaagacaagtttagagcaagtcctgattgtataacaatcctgtgcaaaccgaacggtcaagccattgcgtggtacacccctatccactggaagcaagcgtgggaaaaattagatgctgacgttgaatttaacagatgttcagtagtatctccaacattccgaaagcgtgtgtttcagtggacagcatctacagctacaataactaaagaaaaacaagatcaacctaagaaagatatctcaaattatcaggtggaacaagctcaagttcttcttaagagagagaaggaaatcccaccaaccgttttccctaatcgcagcccttggtgccagaatccctatgtctctgcacatccttactgtcctctgattgaaccacacaatacatccaccgctggaggcagattggatagacagcccaggtctcggtcaaccagacctaatcgagcctcagggtctaagaaaaagaagacatctgagtcacaaaagcaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SUMO/sentrin specific peptidase family member 8
- transcription elongation factor A (SII)-like 4
- family with sequence similarity 119, member A
- family with sequence similarity 119, member B

Buy IFLTD1-intermediate filament tail domain containing 1 Gene now

Add to cart