Login to display prices
Login to display prices
IFLTD1-intermediate filament tail domain containing 1 Gene View larger

IFLTD1-intermediate filament tail domain containing 1 Gene

PTXBC037957

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFLTD1-intermediate filament tail domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFLTD1-intermediate filament tail domain containing 1 Gene

Proteogenix catalog: PTXBC037957
Ncbi symbol: IFLTD1
Product name: IFLTD1-intermediate filament tail domain containing 1 Gene
Size: 2ug
Accessions: BC037957
Gene id: 160492
Gene description: intermediate filament tail domain containing 1
Synonyms: IFLTD1; lamin tail domain-containing protein 1; intermediate filament tail domain containing 1; intermediate filament tail domain-containing protein 1; lamin tail domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattggggatggagaagattatttcctttctttgtttggtgattcaaagaaacttacagcacactcaaactacactcagaaaactttaaaatacttttctatgattcttgaagaagttggccaatttacctccagttctcttggagatgttgaaatagctgaagtgaatgtcaagggtttgttcgtgaagctcattaactcttcccttgacaaagaaatggcaattggagatcatattctccagcaaaatgtgaatggacaaaccatttctttgtaccgattccttccaaacatcgtaatgcaggcaaattccacagtaacagtgtgggcagcagcatctgaagcaaagcatcaacctccatcagattttctttggaaggaacaagacaagtttagagcaagtcctgattgtataacaatcctgtgcaaaccgaacggtcaagccattgcgtggtacacccctatccactggaagcaagcgtgggaaaaattagatgctgacgttgaatttaacagatgttcagtagtatctccaacattccgaaagcgtgtgtttcagtggacagcatctacagctacaataactaaagaaaaacaagatcaacctaagaaagatatctcaaattatcaggtggaacaagctcaagttcttcttaagagagagaaggaaatcccaccaaccgttttccctaatcgcagcccttggtgccagaatccctatgtctctgcacatccttactgtcctctgattgaaccacacaatacatccaccgctggaggcagattggatagacagcccaggtctcggtcaaccagacctaatcgagcctcagggtctaagaaaaagaagacatctgagtcacaaaagcaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice