Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM119B-family with sequence similarity 119, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM119B-family with sequence similarity 119, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016395 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM119B |
| Origin species: | Human |
| Product name: | FAM119B-family with sequence similarity 119, member B Gene |
| Size: | 2ug |
| Accessions: | BC016395 |
| Gene id: | 25895 |
| Gene description: | family with sequence similarity 119, member B |
| Synonyms: | FAM119B; protein-lysine methyltransferase METTL21B; family with sequence similarity 119, member B; hepatocellular carcinoma-associated antigen 557a; hepatocellularcarcinoma-associated antigen HCA557a; methyltransferase-like protein 21B; methyltransferase like 21B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaccccggcccagatcccgaatctgagtcggaatcggtgttcccgcgggaggtcgggctctttgcagactcttactcggagaagagccagttctgtttctgtgggcatgtgctgaccatcacgcagaactttgggtcccgcctcggggtggcggcgcgcgtgtgggacgcggccctgagcctgtgcaattatttcgagagtcaaaatgtggatttccgaggcaagaaggtgatcgaactgggtgcggggacaggcatcgtggggatcttggcagcgctgcaggggggggatgttaccatcactgacctgcccctggccctagaacagatccagggcaacgtccaggccaatgtgccagctggaggccaggcccaggtgcgtgccttgtcctgggggattgaccatcatgtcttccctgcaaactatgacctggtgctgggggctgatatcgtgtacctggaacccaccttccctctgctgctggggaccctccaacacctgtgcaggccccatggcaccatctatctggcctccaagatgagaaaggagcatgggacagagagcttctttcagcacctcctgccccagcatttccaactggagctggctcagcgggatgaggatgaaaatgtcaacatctatagggccaggcacagggaaccaagacctgcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-acetyltransferase 15 (GCN5-related, putative) - Williams Beuren syndrome chromosome region 22 - nuclear receptor subfamily 0, group B, member 2 - family with sequence similarity 153, member B |