FAM119B-family with sequence similarity 119, member B Gene View larger

FAM119B-family with sequence similarity 119, member B Gene

PTXBC016395

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM119B-family with sequence similarity 119, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM119B-family with sequence similarity 119, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016395
Product type: DNA & cDNA
Ncbi symbol: FAM119B
Origin species: Human
Product name: FAM119B-family with sequence similarity 119, member B Gene
Size: 2ug
Accessions: BC016395
Gene id: 25895
Gene description: family with sequence similarity 119, member B
Synonyms: FAM119B; protein-lysine methyltransferase METTL21B; family with sequence similarity 119, member B; hepatocellular carcinoma-associated antigen 557a; hepatocellularcarcinoma-associated antigen HCA557a; methyltransferase-like protein 21B; methyltransferase like 21B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaccccggcccagatcccgaatctgagtcggaatcggtgttcccgcgggaggtcgggctctttgcagactcttactcggagaagagccagttctgtttctgtgggcatgtgctgaccatcacgcagaactttgggtcccgcctcggggtggcggcgcgcgtgtgggacgcggccctgagcctgtgcaattatttcgagagtcaaaatgtggatttccgaggcaagaaggtgatcgaactgggtgcggggacaggcatcgtggggatcttggcagcgctgcaggggggggatgttaccatcactgacctgcccctggccctagaacagatccagggcaacgtccaggccaatgtgccagctggaggccaggcccaggtgcgtgccttgtcctgggggattgaccatcatgtcttccctgcaaactatgacctggtgctgggggctgatatcgtgtacctggaacccaccttccctctgctgctggggaccctccaacacctgtgcaggccccatggcaccatctatctggcctccaagatgagaaaggagcatgggacagagagcttctttcagcacctcctgccccagcatttccaactggagctggctcagcgggatgaggatgaaaatgtcaacatctatagggccaggcacagggaaccaagacctgcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-acetyltransferase 15 (GCN5-related, putative)
- Williams Beuren syndrome chromosome region 22
- nuclear receptor subfamily 0, group B, member 2
- family with sequence similarity 153, member B

Buy FAM119B-family with sequence similarity 119, member B Gene now

Add to cart