Login to display prices
Login to display prices
FAM119B-family with sequence similarity 119, member B Gene View larger

FAM119B-family with sequence similarity 119, member B Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM119B-family with sequence similarity 119, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM119B-family with sequence similarity 119, member B Gene

Proteogenix catalog: PTXBC016395
Ncbi symbol: FAM119B
Product name: FAM119B-family with sequence similarity 119, member B Gene
Size: 2ug
Accessions: BC016395
Gene id: 25895
Gene description: family with sequence similarity 119, member B
Synonyms: FAM119B; protein-lysine methyltransferase METTL21B; family with sequence similarity 119, member B; hepatocellular carcinoma-associated antigen 557a; hepatocellularcarcinoma-associated antigen HCA557a; methyltransferase-like protein 21B; methyltransferase like 21B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaccccggcccagatcccgaatctgagtcggaatcggtgttcccgcgggaggtcgggctctttgcagactcttactcggagaagagccagttctgtttctgtgggcatgtgctgaccatcacgcagaactttgggtcccgcctcggggtggcggcgcgcgtgtgggacgcggccctgagcctgtgcaattatttcgagagtcaaaatgtggatttccgaggcaagaaggtgatcgaactgggtgcggggacaggcatcgtggggatcttggcagcgctgcaggggggggatgttaccatcactgacctgcccctggccctagaacagatccagggcaacgtccaggccaatgtgccagctggaggccaggcccaggtgcgtgccttgtcctgggggattgaccatcatgtcttccctgcaaactatgacctggtgctgggggctgatatcgtgtacctggaacccaccttccctctgctgctggggaccctccaacacctgtgcaggccccatggcaccatctatctggcctccaagatgagaaaggagcatgggacagagagcttctttcagcacctcctgccccagcatttccaactggagctggctcagcgggatgaggatgaaaatgtcaacatctatagggccaggcacagggaaccaagacctgcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: