FAM153B-family with sequence similarity 153, member B Gene View larger

FAM153B-family with sequence similarity 153, member B Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM153B-family with sequence similarity 153, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM153B-family with sequence similarity 153, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028606
Product type: DNA & cDNA
Ncbi symbol: FAM153B
Origin species: Human
Product name: FAM153B-family with sequence similarity 153, member B Gene
Size: 2ug
Accessions: BC028606
Gene id: 202134
Gene description: family with sequence similarity 153, member B
Synonyms: protein FAM153B; family with sequence similarity 153 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggacaaagacacagagagagacattgagatgaaacggcaactacggcgactacgggagctccacctatacagcacatggaagaagtaccaagaggcgatgaagacatccttgggagttccacaatgtgagcgtgacgaaggctccttgggcaagccattgtgtccacccgagatactctcggagacgttgccaggctctgtgaagaaaagggtatgctttccatcagaagatcatctagaggagtttatagcagaacatctccctgaagcatccaatcagagtctcctcactgttgcccatgcagacacaggcatccaaaccaacggtgacctggaagacctggaggagcatgggccagggcagacagtctctgaggaagccacagaagttcacatgatggagggggacccagacacactggccgaacttctgatcagggatgtacttcaggagctgtccagttacaacggcgaggaggaggacccagaggaggtgaagacatccttgggagttccacaacgtggtgacctggaagacctggaggagcatgtgccagggcagacagtctctgaggaagccacaggggttcacatgatgcaggtggacccagccacgccggcaaagagtgacctggaagacctggaggagcatgtgccagggcagacagtctctgaggaagccacaggggttcacatgatgcaggtggacccagccacactggcaaagcgtacgtattctgggatcatctctttgtttaggtgtgaaatcttagtgttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 131, member C
- Williams Beuren syndrome chromosome region 22
- major histocompatibility complex, class I-related
- poly (ADP-ribose) polymerase family, member 11

Buy FAM153B-family with sequence similarity 153, member B Gene now

Add to cart