Login to display prices
Login to display prices
NAT15-N-acetyltransferase 15 (GCN5-related, putative) Gene View larger

NAT15-N-acetyltransferase 15 (GCN5-related, putative) Gene

PTXBC011267

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAT15-N-acetyltransferase 15 (GCN5-related, putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAT15-N-acetyltransferase 15 (GCN5-related, putative) Gene

Proteogenix catalog: PTXBC011267
Ncbi symbol: NAT15
Product name: NAT15-N-acetyltransferase 15 (GCN5-related, putative) Gene
Size: 2ug
Accessions: BC011267
Gene id: 79903
Gene description: N-acetyltransferase 15 (GCN5-related, putative)
Synonyms: NAT15; HAT4; N-alpha-acetyltransferase 60; N-acetyltransferase 15 (GCN5-related, putative); histone acetyltransferase type B protein 4; N(alpha)-acetyltransferase 60, NatF catalytic subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagaggtggtgccatccagcgcgctcagcgaggtcagcctgcgcctcctctgccacgatgacatagacactgtgaagcacctgtgtggcgactggttccccatcgagtacccagactcatggtatcgtgatatcacatccaacaagaagttcttttcccttgctgcaacctacagaggtgccattgtgggaatgatagtagctgaaattaagaacaggaccaaaatacataaagaggatggagatattctagcatccaacttctctgttgacacacaagtcgcgtacatcctaagtctgggcgtcgtgaaagagttcaggaagcacggcataggttccctcttacttgaaagtttaaaggatcacatatcaaccaccgcccaggaccactgcaaagccatttacctgcatgtcctcaccaccaacaacacagcaataaacttctatgaaaacagagacttcaagcagcaccactatctcccctattactactccattcgaggggtcctcaaagatggcttcacctatgtcctctacatcaacggcgggcaccctccctggacgattttggactacatccagcacctgggctctgcactagccagcctgagcccctgctccattccgcacagagtctaccgccaggcccacagcctgctctgcagcttcctgccatggtcgggcatctcttccaagagtggcatcgagtacagccggaccatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: