No products
Prices are tax excluded
PTXBC000169
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000169 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WBSCR22 |
| Origin species: | Human |
| Product name: | WBSCR22-Williams Beuren syndrome chromosome region 22 Gene |
| Size: | 2ug |
| Accessions: | BC000169 |
| Gene id: | 114049 |
| Gene description: | Williams Beuren syndrome chromosome region 22 |
| Synonyms: | ribosome biogenesis methyltransferase WBSCR22; HASJ4442; HUSSY-3; MERM1; PP3381; WBMT; Williams-Beuren candidate region putative methyltransferase; Williams-Beuren syndrome chromosomal region 22 protein; bud site selection protein 23 homolog; metastasis-related methyltransferase 1; Williams-Beuren syndrome chromosome region 22 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattgatatccagaccaggatggctgggcgagcattggagcttctttatctgccagagaataagccctgttacctgctggatattggctgtggcactgggctgagtggaagttatctgtcagatgaagggcactattgggtgggcctggatatcagccctgccatgctggatgaggctgtggaccgagagatagagggagacctgctgctgggggatatgggccagggcatcccattcaagccaggcacatttgatggttgcatcagcatttctgctgtgcagtggctctgtaatgctaacaagaagtctgaaaaccctgccaagcgcctgtactgcttttttgcttctcttttttctgttctcgtccggggatcccgagctgtcctgcagctgtaccctgagaactcagagcagttggagctgatcacaacccaggccacaaaggcaggcttctccggtggcatggtggtagactaccctaacagtgccaaagcaaagaaattctacctctgcttgttttctgggccttcgacctttataccagaggggctgagtgaaaatcaggatgaagttgaacccagggagtctgtgttcaccaatgagaggttcccattaaggatgtcgaggcggggaatggtgaggaagagtcgggcatgggtgctggagaagaaggagcggcacaggcgccagggcagggaagtcagacctgacacccagtacaccggccgcaagcgcaagccccgcttctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear receptor subfamily 0, group B, member 2 - family with sequence similarity 153, member B - family with sequence similarity 131, member C - Williams Beuren syndrome chromosome region 22 |