WBSCR22-Williams Beuren syndrome chromosome region 22 Gene View larger

WBSCR22-Williams Beuren syndrome chromosome region 22 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WBSCR22-Williams Beuren syndrome chromosome region 22 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about WBSCR22-Williams Beuren syndrome chromosome region 22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000169
Product type: DNA & cDNA
Ncbi symbol: WBSCR22
Origin species: Human
Product name: WBSCR22-Williams Beuren syndrome chromosome region 22 Gene
Size: 2ug
Accessions: BC000169
Gene id: 114049
Gene description: Williams Beuren syndrome chromosome region 22
Synonyms: ribosome biogenesis methyltransferase WBSCR22; HASJ4442; HUSSY-3; MERM1; PP3381; WBMT; Williams-Beuren candidate region putative methyltransferase; Williams-Beuren syndrome chromosomal region 22 protein; bud site selection protein 23 homolog; metastasis-related methyltransferase 1; Williams-Beuren syndrome chromosome region 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattgatatccagaccaggatggctgggcgagcattggagcttctttatctgccagagaataagccctgttacctgctggatattggctgtggcactgggctgagtggaagttatctgtcagatgaagggcactattgggtgggcctggatatcagccctgccatgctggatgaggctgtggaccgagagatagagggagacctgctgctgggggatatgggccagggcatcccattcaagccaggcacatttgatggttgcatcagcatttctgctgtgcagtggctctgtaatgctaacaagaagtctgaaaaccctgccaagcgcctgtactgcttttttgcttctcttttttctgttctcgtccggggatcccgagctgtcctgcagctgtaccctgagaactcagagcagttggagctgatcacaacccaggccacaaaggcaggcttctccggtggcatggtggtagactaccctaacagtgccaaagcaaagaaattctacctctgcttgttttctgggccttcgacctttataccagaggggctgagtgaaaatcaggatgaagttgaacccagggagtctgtgttcaccaatgagaggttcccattaaggatgtcgaggcggggaatggtgaggaagagtcgggcatgggtgctggagaagaaggagcggcacaggcgccagggcagggaagtcagacctgacacccagtacaccggccgcaagcgcaagccccgcttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear receptor subfamily 0, group B, member 2
- family with sequence similarity 153, member B
- family with sequence similarity 131, member C
- Williams Beuren syndrome chromosome region 22

Buy WBSCR22-Williams Beuren syndrome chromosome region 22 Gene now

Add to cart