Login to display prices
Login to display prices
FAM119A-family with sequence similarity 119, member A Gene View larger

FAM119A-family with sequence similarity 119, member A Gene

PTXBC033720

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM119A-family with sequence similarity 119, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM119A-family with sequence similarity 119, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033720
Product type: DNA & cDNA
Ncbi symbol: FAM119A
Origin species: Human
Product name: FAM119A-family with sequence similarity 119, member A Gene
Size: 2ug
Accessions: BC033720
Gene id: 151194
Gene description: family with sequence similarity 119, member A
Synonyms: FAM119A; HCA557b; HSPA-KMT; protein N-lysine methyltransferase METTL21A; HSPA lysine methyltransferase; family with sequence similarity 119, member A; heat shock protein 70kDa lysine (K) methyltransferase; hepatocellular carcinoma-associated antigen 557b; methyltransferase-like protein 21A; methyltransferase like 21A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctcgtgccctatgaggagaccacggaatttgggttgcagaaattccacaagcctcttgcaactttttcctttgcaaaccacacgatccagatccggcaggactggagacacctgggagtcgcagcggtggtttgggatgcggccatcgttctttccacatacctggagatgggagctgtggagctcaggggccgctctgccgtggagctgggtgctggcacggggctggtgggcatagtggctgccctgctgggtgctcatgtgactatcacggatcgaaaagtagcattagaatttcttaaatcaaacgttcaagccaacttacctcctcatatccaaactaaaactgttgttaaggagctgacttggggacaaaatttggggagtttttctcctggagaatttgacctgatacttggtgctgatatcatatatttagaagaaacattcacagatcttcttcaaacactggaacatctctgtagcaatcactctgtgattcttttagcatgccgaattcgctatgaacgggataacaacttcttagcaatgctggagaggcaatttattgtgagaaaggttcactacgatcctgaaaaagatgtacatatttacgaagcacagaagagaaaccagaaggaggacttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 119, member B
- N-acetyltransferase 15 (GCN5-related, putative)
- Williams Beuren syndrome chromosome region 22
- nuclear receptor subfamily 0, group B, member 2