Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SENP8-SUMO/sentrin specific peptidase family member 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SENP8-SUMO/sentrin specific peptidase family member 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031411 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SENP8 |
| Origin species: | Human |
| Product name: | SENP8-SUMO/sentrin specific peptidase family member 8 Gene |
| Size: | 2ug |
| Accessions: | BC031411 |
| Gene id: | 123228 |
| Gene description: | SUMO/sentrin specific peptidase family member 8 |
| Synonyms: | NEDP1; PRSC2; sentrin-specific protease 8; NEDD8 specific-protease cysteine 2; NEDD8-specific protease 1; SUMO sentrin specific protease family member 8; SUMO/sentrin specific peptidase family member 8; deneddylase 1; protease, cysteine 2; SUMO/sentrin peptidase family member, NEDD8 specific |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaccccgtagtcttgagttacatggacagtctactgcggcaatcagatgtctcactattggatccgccaagctggctcaatgaccatattattgggtttgcgtttgagtactttgccaacagtcagtttcatgactgctctgatcacgtcagtttcatcagccctgaagtcacccagttcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactggacctccccaacaagagagttgtatttttagccatcaatgataactccaaccaggcagctggaggaacccactggagtttattggtctacctccaagataaaaatagcttttttcattatgattcccatagcaggagcaactcagttcacgcaaagcaggtagcagagaaactggaggctttcttaggcagaaaaggagacaaactggcctttgtggaagagaaagcccctgcccaacaaaacagctatgactgtgggatgtacgtgatatgtaacactgaggccttgtgtcagaacttctttaggcaacagacagaatcactgctgcagctactcacccctgcatacatcacaaagaagaggggagaatggaaagatctcattgccacacttgctaaaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcription elongation factor A (SII)-like 4 - family with sequence similarity 119, member A - family with sequence similarity 119, member B - N-acetyltransferase 15 (GCN5-related, putative) |