COX6A2-cytochrome c oxidase subunit VIa polypeptide 2 Gene View larger

COX6A2-cytochrome c oxidase subunit VIa polypeptide 2 Gene

PTXBC029818

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX6A2-cytochrome c oxidase subunit VIa polypeptide 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COX6A2-cytochrome c oxidase subunit VIa polypeptide 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029818
Product type: DNA & cDNA
Ncbi symbol: COX6A2
Origin species: Human
Product name: COX6A2-cytochrome c oxidase subunit VIa polypeptide 2 Gene
Size: 2ug
Accessions: BC029818
Gene id: 1339
Gene description: cytochrome c oxidase subunit VIa polypeptide 2
Synonyms: COX6AH; COXVIAH; cytochrome c oxidase subunit 6A2, mitochondrial; COX VIa-M; cytochrome c oxidase polypeptide VIa-heart; cytochrome c oxidase subunit VIA-muscle; cytochrome c oxidase subunit VIa polypeptide 2; cytochrome c oxidase subunit 6A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctttgcctctgaggcccctgacccggggcttggccagcgctgccaaaggaggccacggaggagcaggagctcgtacctggcgtctgctgaccttcgtgctggcgctgcccagcgtggccctctgcaccttcaactcctatctccactcgggccaccgcccgcgccccgagttccgtccctaccaacacctccgcatccgcaccaagccctacccctggggggacggcaaccacactctgttccacaatagccacgtgaaccctctgcccacgggctacgaacacccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - intermediate filament tail domain containing 1
- SUMO/sentrin specific peptidase family member 8
- transcription elongation factor A (SII)-like 4
- family with sequence similarity 119, member A

Buy COX6A2-cytochrome c oxidase subunit VIa polypeptide 2 Gene now

Add to cart