Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of COX6A2-cytochrome c oxidase subunit VIa polypeptide 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX6A2-cytochrome c oxidase subunit VIa polypeptide 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029818 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX6A2 |
| Origin species: | Human |
| Product name: | COX6A2-cytochrome c oxidase subunit VIa polypeptide 2 Gene |
| Size: | 2ug |
| Accessions: | BC029818 |
| Gene id: | 1339 |
| Gene description: | cytochrome c oxidase subunit VIa polypeptide 2 |
| Synonyms: | COX6AH; COXVIAH; cytochrome c oxidase subunit 6A2, mitochondrial; COX VIa-M; cytochrome c oxidase polypeptide VIa-heart; cytochrome c oxidase subunit VIA-muscle; cytochrome c oxidase subunit VIa polypeptide 2; cytochrome c oxidase subunit 6A2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctttgcctctgaggcccctgacccggggcttggccagcgctgccaaaggaggccacggaggagcaggagctcgtacctggcgtctgctgaccttcgtgctggcgctgcccagcgtggccctctgcaccttcaactcctatctccactcgggccaccgcccgcgccccgagttccgtccctaccaacacctccgcatccgcaccaagccctacccctggggggacggcaaccacactctgttccacaatagccacgtgaaccctctgcccacgggctacgaacacccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - intermediate filament tail domain containing 1 - SUMO/sentrin specific peptidase family member 8 - transcription elongation factor A (SII)-like 4 - family with sequence similarity 119, member A |