CD36-CD36 molecule (thrombospondin receptor) Gene View larger

CD36-CD36 molecule (thrombospondin receptor) Gene

PTXBC008406

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD36-CD36 molecule (thrombospondin receptor) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD36-CD36 molecule (thrombospondin receptor) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008406
Product type: DNA & cDNA
Ncbi symbol: CD36
Origin species: Human
Product name: CD36-CD36 molecule (thrombospondin receptor) Gene
Size: 2ug
Accessions: BC008406
Gene id: 948
Gene description: CD36 molecule (thrombospondin receptor)
Synonyms: CD36 molecule; leukocyte differentiation antigen CD36; CD36 molecule (thrombospondin receptor); CD36 antigen (collagen type I receptor, thrombospondin receptor); BDPLT10; CHDS7; FAT; GP3B; GP4; GPIV; PASIV; SCARB3; platelet glycoprotein 4; GPIIIB; PAS IV; PAS-4 protein; cluster determinant 36; fatty acid translocase; glycoprotein IIIb; platelet glycoprotein IV; scavenger receptor class B, member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgtgaccggaactgtgggctcatcgctggggctgtcattggtgctgtcctggctgtgtttggaggtattctaatgccagttggagacctgcttatccagaagacaattaaaaagcaagttgtcctcgaagaaggtacaattgcttttaaaaattgggttaaaacaggcacagaagtttacagacagttttggatctttgatgtgcaaaatccacaggaagtgatgatgaacagcagcaacattcaagttaagcaaagaggtccttatacgtacagagttcgttttctagccaaggaaaatgtaacccaggacgctgaggacaacacagtctctttcctgcagcccaatggtgccatcttcgaaccttcactatcagttggaacagaggctgacaacttcacagttctcaatctggctgtggcagctgcatcccatatctatcaaaatcaatttgttcaaatgatcctcaattcacttattaacaagtcaaaatcttctatgttccaagtcagaactttgagagaactgttatggggctatagggatccatttttgagtttggttccataccctgttactaccacagttggtctgttttatccttacaacaatactgcagatggagtttataaagttttcaatggaaaagataacataagtaaagttgccataatcgacacatataaaggtaaaaggaatctgtcctattgggaaagtcactgcgacatgattaatggtacagatgcagcctcatttccaccttttgttgagaaaagccaggtattgcagttcttttcttctgatatttgcaggtcaatctatgctgtatttgaatccgacgttaatctgaaaggaatccctgtgtatagatttgttcttccatccaaggcctttgcctctccagttgaaaacccagacaactattgtttctgcacagaaaaaattatctcaaaaaattgtacatcatatggtgtgctagacatcagcaaatgcaaagaagggagacctgtgtacatttcacttcctcattttctgtatgcaagtcctgatgtttcagaacctattgatggattaaacccaaatgaagaagaacataggacatacttggatattgaacctataactggattcactttacaatttgcaaaacggctgcaggtcaacctattggtcaagccatcagaaaaaattcaagtattaaagaatctgaagaggaactatattgtgcctattctttggcttaatgagactgggaccattggtgatgagaaggcaaacatgttcagaagtcaagtaactggaaaaataaacctccttggcctgatagaaatgatcttactcagtgttggtgtggtgatgtttgttgcttttatgatttcatattgtgcatgcagatcgaaaacaataaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 14
- chromosome 10 open reading frame 63
- chromosome 22 open reading frame 32
- ATPase family, AAA domain containing 1

Buy CD36-CD36 molecule (thrombospondin receptor) Gene now

Add to cart