C10orf63-chromosome 10 open reading frame 63 Gene View larger

C10orf63-chromosome 10 open reading frame 63 Gene

PTXBC026165

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf63-chromosome 10 open reading frame 63 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf63-chromosome 10 open reading frame 63 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026165
Product type: DNA & cDNA
Ncbi symbol: C10orf63
Origin species: Human
Product name: C10orf63-chromosome 10 open reading frame 63 Gene
Size: 2ug
Accessions: BC026165
Gene id: 219670
Gene description: chromosome 10 open reading frame 63
Synonyms: C10orf63; CFAP106; enkurin; enkurin, TRPC channel interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatccaacgtgctcttctgagtgcatttataacctcatacccagtgacttgaaggagcctccccagcctcctaggtacatatccatttttaaggcaactgtaaaagatgacatgcaaaaagctaaaactgcaatgaaaactatgggaccagcaaaagttgaagtaccttctccaaaggatttcctaaagaaacattcaaaggaaaaaactctaccacccaaaaaaaactttgatcggaacgtgcccaaaaagcctgctgtgccattgaagactgatcatcctgtcatgggaatacagagtggaaaaaattttataaatacaaatgcagctgatatcatcatgggagtggctaaaaagcctaaaccaatttatgttgataaaagaactggagacaagcatgatcttgagccttcaggactagttccaaagtacatcaataaaaaggattatggtgtcacacctgaatacatatgtaagcgaaacgaggaaataaagaaagcccaagaagactatgatcgttatatccaggaaaaccttaagaaagcagctatgaaaaggctctccgatgaagaaagggaggcagttttgcaggggctgaaaaagaactgggaagaggtgcataaagaattccagtccctctcggtctttatagattctataccaaagaagatccgcaagcagaggctggaagaagaaatgaaacaactagaacacgacattggcataattgaaaagcacaagattatttatattgccaataacgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 22 open reading frame 32
- ATPase family, AAA domain containing 1
- chromosome 12 open reading frame 65
- chromosome 13 open reading frame 18

Buy C10orf63-chromosome 10 open reading frame 63 Gene now

Add to cart