C22orf32-chromosome 22 open reading frame 32 Gene View larger

C22orf32-chromosome 22 open reading frame 32 Gene

PTXBC024237

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C22orf32-chromosome 22 open reading frame 32 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C22orf32-chromosome 22 open reading frame 32 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024237
Product type: DNA & cDNA
Ncbi symbol: C22orf32
Origin species: Human
Product name: C22orf32-chromosome 22 open reading frame 32 Gene
Size: 2ug
Accessions: BC024237
Gene id: 91689
Gene description: chromosome 22 open reading frame 32
Synonyms: UPF0466 protein C22orf32, mitochondrial; C22orf32; DDDD; EMRE; dJ186O1.1; essential MCU regulator, mitochondrial; single-pass membrane protein with aspartate-rich tail 1, mitochondrial; single-pass membrane protein with aspartate rich tail 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccggagcggctcgctggctagtattggcacccgtcaggtccggggctctccggagcgggcctagcttgaggaaagatggcgatgtctccgccgcatggagcggctcaggccggagcctggtaccgtcggggtcagtcatcgttacccgcagcggcgccattttgcccaaaccggtgaaaatgtccttcggccttctgcgtgtgttctccattgtgatcccctttctctatgtcgggacactcattagcaagaactttgctgctctacttgaggaacatgacatttttgttccagaggatgatgatgatgatgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase family, AAA domain containing 1
- chromosome 12 open reading frame 65
- chromosome 13 open reading frame 18
- chromosome Y open reading frame 15B

Buy C22orf32-chromosome 22 open reading frame 32 Gene now

Add to cart