Login to display prices
Login to display prices
ATAD1-ATPase family, AAA domain containing 1 Gene View larger

ATAD1-ATPase family, AAA domain containing 1 Gene

PTXBC010868

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATAD1-ATPase family, AAA domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATAD1-ATPase family, AAA domain containing 1 Gene

Proteogenix catalog: PTXBC010868
Ncbi symbol: ATAD1
Product name: ATAD1-ATPase family, AAA domain containing 1 Gene
Size: 2ug
Accessions: BC010868
Gene id: 84896
Gene description: ATPase family, AAA domain containing 1
Synonyms: AFDC1; FNP001; THORASE; ATPase family AAA domain-containing protein 1; ATPase family, AAA domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgaaagctcagtttatgagtctctgggatggattggatactgatcacagctgccaggtcatagtaatgggagctaccaatcgtcctcaggaccttgactcggctataatgagaagaatgcctacaagatttcatatcaaccagcctgctttaaaacagagagaagcaatcctgaaactcatcttgaaaaatgaaaatgtggataggcatgtagacctgctagaagttgcccaggaaactgatgggttttcaggaagtgacctaaaagagatgtgtcgagatgctgccctcctctgtgttagagaatatgttaattctacatcagaagaaagccatgacgaagatgaaattcggcctgttcaacagcaggacctgcatcgggcaattgaaaagatgaagaaatcaaaggatgcagcatttcagaatgttttaacacatgtttgtttagattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: