ATAD1-ATPase family, AAA domain containing 1 Gene View larger

ATAD1-ATPase family, AAA domain containing 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATAD1-ATPase family, AAA domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATAD1-ATPase family, AAA domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010868
Product type: DNA & cDNA
Ncbi symbol: ATAD1
Origin species: Human
Product name: ATAD1-ATPase family, AAA domain containing 1 Gene
Size: 2ug
Accessions: BC010868
Gene id: 84896
Gene description: ATPase family, AAA domain containing 1
Synonyms: AFDC1; FNP001; THORASE; ATPase family AAA domain-containing protein 1; ATPase family, AAA domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgaaagctcagtttatgagtctctgggatggattggatactgatcacagctgccaggtcatagtaatgggagctaccaatcgtcctcaggaccttgactcggctataatgagaagaatgcctacaagatttcatatcaaccagcctgctttaaaacagagagaagcaatcctgaaactcatcttgaaaaatgaaaatgtggataggcatgtagacctgctagaagttgcccaggaaactgatgggttttcaggaagtgacctaaaagagatgtgtcgagatgctgccctcctctgtgttagagaatatgttaattctacatcagaagaaagccatgacgaagatgaaattcggcctgttcaacagcaggacctgcatcgggcaattgaaaagatgaagaaatcaaaggatgcagcatttcagaatgttttaacacatgtttgtttagattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 65
- chromosome 13 open reading frame 18
- chromosome Y open reading frame 15B
- peroxisomal trans-2-enoyl-CoA reductase

Buy ATAD1-ATPase family, AAA domain containing 1 Gene now

Add to cart