Login to display prices
Login to display prices
C16orf14-chromosome 16 open reading frame 14 Gene View larger

C16orf14-chromosome 16 open reading frame 14 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf14-chromosome 16 open reading frame 14 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf14-chromosome 16 open reading frame 14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007346
Product type: DNA & cDNA
Ncbi symbol: C16orf14
Origin species: Human
Product name: C16orf14-chromosome 16 open reading frame 14 Gene
Size: 2ug
Accessions: BC007346
Gene id: 84331
Gene description: chromosome 16 open reading frame 14
Synonyms: C16orf14; FAM195A; c349E10.1; MAPK regulated corepressor interacting protein 2; MAPK regulated co-repressor interacting protein 2; family with sequence similarity 195, member A; protein FAM195A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacaccatcaccaaggggcccagcaagctggtcgcgcagcgccgcacaggtcccacgcagcagcaggtggagggccggctcggcgagctcctgaaatgccggcagcccgcgccgccgacctcgcagcccccgcgggcgcagccctttgcgcagccgccgggaccctggcccctgtcgagcctggcagcaggtgcaacagcagctggatggtggcccagccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 63
- chromosome 22 open reading frame 32
- ATPase family, AAA domain containing 1
- chromosome 12 open reading frame 65