Login to display prices
Login to display prices
SLC4A4-solute carrier family 4, sodium bicarbonate cotransporter, member 4 Gene View larger

SLC4A4-solute carrier family 4, sodium bicarbonate cotransporter, member 4 Gene


New product

Data sheet of SLC4A4-solute carrier family 4, sodium bicarbonate cotransporter, member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC4A4-solute carrier family 4, sodium bicarbonate cotransporter, member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030977
Product type: DNA & cDNA
Ncbi symbol: SLC4A4
Origin species: Human
Product name: SLC4A4-solute carrier family 4, sodium bicarbonate cotransporter, member 4 Gene
Size: 2ug
Accessions: BC030977
Gene id: 8671
Gene description: solute carrier family 4, sodium bicarbonate cotransporter, member 4
Synonyms: HNBC1; KNBC; NBC1; NBC2; NBCe1-A; SLC4A5; hhNMC; kNBC1; pNBC; electrogenic sodium bicarbonate cotransporter 1; Na(+)/HCO3(-) cotransporter; sodium bicarbonate cotransporter 1 (sodium bicarbonate cotransporter, kidney; sodium bicarbonate cotransporter, pancreas); solute carrier family 4 (sodium bicarbonate cotransporter), member 4; solute carrier family 4, sodium bicarbonate cotransporter, member 4, brain type; solute carrier family 4, sodium bicarbonate cotransporter, member 5; solute carrier family 4 member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccactgaaaatgtggaagggaagcccagtaaccttggggagagaggaagagcccggagctccactttcctcagggttgtccagccaatgtttaaccacagtattttcacttctgcagtctctcctgctgcagaacgcatccgattcatcttgggagaggaggatgacagcccagctccccctcagctcttcacggaactggatgagctgctggccgtggatgggcaggagatggagtggaaggaaacagccaggtggatcaagtttgaagaaaaagtggaacagggtggggaaagatggagcaagccccatgtggccacattgtcccttcatagtttatttgagctgaggacatgtatggagaaaggatccatcatgcttgatcgggaggcttcttctctcccacagttggtggagatgattgttgaccatcagattgagacaggcctattgaaacctgaacttaaggataaggtgacctatactttgctccggaagcaccggcatcaaaccaagaaatccaaccttcggtccctggctgacattgggaagacagtctccagtgcaagtaggatgtttaccaaccctgataatggtagcccagccatgacccataggaatctgacttcctccagtctgaatgacatttctgataaaccggagaaggaccagctgaagaataagttcatgaaaaaattgccacgtgatgcagaagcttccaacgtgcttgttggggaggttgactttttggatactcctttcattgcctttgttaggctacagcaggctgtcatgctgggtgccctgactgaagttcctgtgcccacaaggttcttgttcattctcttaggtcctaaggggaaagccaagtcctaccacgagattggcagagccattgccaccctgatgtctgatgaggtgttccatgacattgcttataaagcaaaagacaggcacgacctgattgctggtattgatgagttcctagatgaagtcatcgtccttccacctggggaatgggatccagcaattaggatagagcctcctaagagtcttccatcctctgacaaaagaaagaatatgtactcaggtggagagaatgttcagatgaatggggatacgccccatgatggaggtcacggaggaggaggacatggggattgtgaagaattgcagcgaactggacggttctgtggtggactaattaaagacataaagaggaaagcgccattttttgccagtgatttttatgatgctttaaatattcaagctctttcggcaattctcttcatttatctggcaactgtaactaatgctatcacttttggaggactgcttggggatgccactgacaacatgcagggcgtgttggagagtttcctgggcactgctgtctctggagccatcttttgcctttttgctggtcaaccactcactattctgagcagcaccggacctgtcctagtttttgagaggcttctatttaatttcagcaaggacaataattttgactatttggagtttcgcctttggattggcctgtggtccgccttcctatgtctcattttggtagccactgatgccagcttcttggttcaatacttcacacgtttcacggaggagggcttttcctctctgattagcttcatctttatctatgatgctttcaagaagatgatcaagcttgcagattactaccccatcaactccaacttcaaagtgggctacaacactctcttttcctgtacctgtgtgccacctgacccaggtgagggcattacgctttgtgtttatgctcgctttgtatttggaggaaggtgtaggctccatgcttgcaaattttcaacatgctgtcatggtcctcaggaattagtcttgtttttttctctgaaaaactctgctactgaatttgatgtctcattgcctgaggtattttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - golgi associated, gamma adaptin ear containing, ARF binding protein 1
- solute carrier family 2 (facilitated glucose transporter), member 2
- golgi associated, gamma adaptin ear containing, ARF binding protein 1
- chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)