PTXBC069700
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069700 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL18 |
| Origin species: | Human |
| Product name: | CCL18-chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) Gene |
| Size: | 2ug |
| Accessions: | BC069700 |
| Gene id: | 6362 |
| Gene description: | chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) |
| Synonyms: | AMAC-1; AMAC1; CKb7; DC-CK1; DCCK1; MIP-4; PARC; SCYA18; C-C motif chemokine 18; CC chemokine PARC; CC chemokine ligand 18; alternative macrophage activation-associated CC chemokine 1; chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated); chemokine (C-C), dendritic; dendritic cell chemokine 1; macrophage inflammatory protein 4; pulmonary and activation-regulated chemokine; small inducible cytokine A18; small inducible cytokine subfamily A (Cys-Cys), member 18, pulmonary and activation-regulated; C-C motif chemokine ligand 18 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagggccttgcagctgccctccttgtcctcgtctgcaccatggccctctgctcctgtgcacaagttggtaccaacaaagagctctgctgcctcgtctatacctcctggcagattccacaaaagttcatagttgactattctgaaaccagcccccagtgccccaagccaggtgtcatcctcctaaccaagagaggccggcagatctgtgctgaccccaataagaagtgggtccagaaatacatcagcgacctgaagctgaatgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 62 (C2 domain containing), member A - solute carrier family 2 (facilitated glucose transporter), member 4 - integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) - FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) |