Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC2A2-solute carrier family 2 (facilitated glucose transporter), member 2 Gene
PTXBC060041
New product
Data sheet of SLC2A2-solute carrier family 2 (facilitated glucose transporter), member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC2A2-solute carrier family 2 (facilitated glucose transporter), member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060041 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC2A2 |
| Origin species: | Human |
| Product name: | SLC2A2-solute carrier family 2 (facilitated glucose transporter), member 2 Gene |
| Size: | 2ug |
| Accessions: | BC060041 |
| Gene id: | 6514 |
| Gene description: | solute carrier family 2 (facilitated glucose transporter), member 2 |
| Synonyms: | GLUT2; solute carrier family 2, facilitated glucose transporter member 2; glucose transporter type 2, liver; solute carrier family 2 (facilitated glucose transporter), member 2; solute carrier family 2 member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtatatcggtgaaattgctccaaccgctctcaggggagcacttggcacttttcatcagctggccatcgtcacgggcattcttattagtcagattattggtcttgaatttatcttgggcaattatgatctgtggcacatcctgcttggcctgtctggtgtgcgagccatccttcagtctctgctactctttttctgtccagaaagccccagatacctttacatcaagttagatgaggaagtcaaagcaaaacaaagcttgaaaagactcagaggatatgatgatgtcaccaaagatattaatgaaatgagaaaagaaagagaagaagcatcgagtgagcagaaagtctctataattcagctcttcaccaattccagctaccgacagcctattctagtggcactgatgctgcatgtggctcagcaattttccggaatcaatggcattttttactactcaaccagcatttttcagacggctggtatcagcaaacctgtttatgcaaccattggagttggcgctgtaaacatggttttcactgctgtctctgtattccttgtggagaaggcagggcgacgttctctctttctaattggaatgagtgggatgtttgtttgtgccatcttcatgtcagtgggacttgtgctgctgaataagttctcttggatgagttatgtgagcatgatagccatcttcctctttgtcagcttctttgaaattgggccaggcccgatcccctggttcatggtggctgagtttttcagtcaaggaccacgtcctgctgctttagcaatagctgcattcagcaattggacctgcaatttcattgtagctctgtgtttccagtacattgcggacttctgtggaccttatgtgtttttcctctttgctggagtgctcctggcctttaccctgttcacattttttaaagttccagaaaccaaaggaaagtcttttgaggaaattgctgcagaattccaaaagaagagtggctcagcccacaggccaaaagctgctgtagaaatgaaattcctaggagctacagagactgtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - golgi associated, gamma adaptin ear containing, ARF binding protein 1 - chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) - family with sequence similarity 62 (C2 domain containing), member A - solute carrier family 2 (facilitated glucose transporter), member 4 |