GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene View larger

GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene

PTXBC044629

New product

Data sheet of GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC044629
Product type: DNA & cDNA
Ncbi symbol: GGA1
Origin species: Human
Product name: GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene
Size: 2ug
Accessions: BC044629
Gene id: 26088
Gene description: golgi associated, gamma adaptin ear containing, ARF binding protein 1
Synonyms: ADP-ribosylation factor-binding protein GGA1; ADP-ribosylation factor binding protein 1; gamma-adaptin related protein 1; golgi-localized, gamma ear-containing, ARF-binding protein 1; golgi associated, gamma adaptin ear containing, ARF binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcccgcgatggagccggagactctggaggcgcgaatcaatagagccacgaaccccctgaacaaggagctcgactgggccagcatcaacggcttctgcgagcagctcaacgaggactttgaggggcctccactcgccacccggctgctggcccacaagatccagtccccacaggagtgggaggcgatccaggccttgacggtgctggaaacatgcatgaagagctgcggcaagcggttccacgacgaagtgggcaagttccgctttctcaacgagctcatcaaggtcgtgtctcccaagtatctgggctctcggacatcggagaaggtgaagaacaagatcttggagctcctctacagctggacagtgggcctgcccgaggaggtgaaaatcgcagaggcctaccagatgctaaagaagcaggggattgtaaagtccgaccccaagcttccagatgacactacctttccccttcctcctccacggccgaagaatgtgatctttgaagatgaggagaaatccaagatgctggcccgcctgctgaagagctcccatcccgaagacctccgcgcagccaataagctcatcaaagagatggtgcaggaggaccagaagcggatggagaagatctcgaagagggtgaatgccatcgaggaggtgaacaacaatgtgaaactgctcacggagatggtgatgagccacagccagggcggcgcagcagctggcagcagcgaggacctcatgaaggaactgtaccagcgctgtgagcggatgcggcccacgctcttccgactggcgagtgacacagaggacaatgatgaggccttaggcctcagtgaccccacacccccttcaggcccaagcctggatggtaccggatggaacagcttccagtcgtcggatgccactgagcccccagcccctgctctggcccaggcccccagtatggaaagccgacccccagcgcagacatccctgccagcaagcagcggtctggacgacctagacctcctggggaagaccctcctgcagcagtcgctgcccccggaatcccagcaagtgcggtgggagaagcagcagccaaccccccggctcacactccgggacctgcagaataagagcagcagctgcagctcccccagctccagcgccaccagccttctccacaccgtgtccccagagccccccaggcctccgcagcagcccgtaccaaccgagctctcactggccagcatcactgtgcccctggagtccatcaaacccagcaacatcctgcccgtgactgtgtatgaccagcacggcttccgcatcctcttccattttgcccgggacccactgccagggcgctccgacgtgctggtggtggtggtttccatgctgagcaccgccccccagcccatccgcaacatcgtgttccagtcagctgtccccaaggttatgaaggtgaagctgcagccaccctcgggcacggagctgccagcttttaaccccatcgtccacccctcagcaatcacccaggtcctgctgcttgccaacccccagaaggagaaggttcgcctccgctacaagctcaccttcaccatgggtgaccagacctacaacgagatgggggatgtggaccagttccccccacctgaaacctggggtagcctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)
- family with sequence similarity 62 (C2 domain containing), member A
- solute carrier family 2 (facilitated glucose transporter), member 4
- integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)

Buy GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene now

Add to cart